SubtiWiki SubtiWiki
opuCC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

opuCC
168

glycine betaine/carnitine/choline/arsenobetaine/arsenocholine [wiki|ABC transporter] (binding protein)

locus
BSU_33810
Molecular weight
33.80 kDa
pI
5.69
Protein length
Gene length
function
compatible solute transport
product
glycine betaine/carnitine/choline/arsenobetaine/arsenocholine [wiki|ABC transporter] (binding protein)
essential
no
synonyms
opuCC, yvbC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1732

This gene is a member of the following regulons

Gene
Coordinates
3,468,253 → 3,469,164
The protein
Catalyzed reaction/ biological activity
uptake of glycine betaine, arsenocholine and arsenobetaine [pubmed|29159878]
Protein family
OsmX family (with [protein|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC], according to UniProt)
Structure
[PDB|3PPN]  [Pubmed|21366542]
Paralogous protein(s)
[protein|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]
[wiki|Localization]
associated to the membrane (via [protein|83C45215AC86FACB08CF36EB5F9E6B076D7D0F0F|opuCB]-[protein|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|opuCD]) [Pubmed|10092453]
lipoprotein [Pubmed|10216873]
Expression and Regulation
Operons
genes
[gene|75DB6231129C28C5D3791BA43A1261CD46A861E8|opuCA]-[gene|83C45215AC86FACB08CF36EB5F9E6B076D7D0F0F|opuCB]-[gene|CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08|opuCC]-[gene|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|opuCD]
description
[Pubmed|10216873]
regulation
induced by salt stress [Pubmed|23960087,10216873]
induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR] [pubmed|30355672]
regulatory mechanism
[protein|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR]: repression, (sterical interference with RNA polymerase access) [Pubmed|32849357,23960087], in [regulon|protein:9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR regulon]
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR]: unknown, [pubmed|30355672], in [regulon|protein:F4097349A563503468A2A14F062AEAC532C7917A|ylxR regulon]
Open in new tab

[gene|75DB6231129C28C5D3791BA43A1261CD46A861E8|opuCA]→[gene|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|opuCD]

2021-06-29 02:09:28

Jstuelk

8

b9927d3ec864bbf0176dc1d26fc265e785d98904

9D14B27F8C4184140FD87446DE1DB30E21C27343

Biological materials
Mutant
BKE33810 (Δ[gene|CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08|opuCC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGTCATTTTCAACAGTGCCA,  downstream forward: _UP4_GACTAAGAAAAGAGGTGGAT
BKK33810 (Δ[gene|CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08|opuCC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGTCATTTTCAACAGTGCCA,  downstream forward: _UP4_GACTAAGAAAAGAGGTGGAT
References
Reviews
27935846
Original Publications
10092453,9925583,10216873,21296969,21366542,23960087,23646920,28256787,29159878

CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08

Page visits: 1078

Time of last update: 2021-09-09 19:16:42

Author of last update: Melvin.boenninger