SubtiWiki SubtiWiki
mtnU

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

mtnU
168

omega-amidase

locus
BSU_13570
Molecular weight
29.25 kDa
pI
5.1
Protein length
Gene length
function
methionine salvage
product
omega-amidase
essential
no
synonyms
mtnU, ykrU

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0388

This gene is a member of the following regulons

Gene
Coordinates
1,424,767 → 1,425,546
Phenotypes of a mutant
reduced growth with 5-methylthioribose as single sulfur source [Pubmed|24837359]
The protein
Catalyzed reaction/ biological activity
2-ketoglutaramate + H2O --→ 2-oxoglutarate + NH3 [Pubmed|24837359]
Protein family
carbon-nitrogen hydrolase superfamily (with [protein|BDAA216E832B8EB267CED6456A0045254DD0E97D|yhcX], according to UniProt)
[wiki|Domains]
CN hydrolase (aa 3-238) (according to UniProt)
Structure
[PDB|3P8K] (from Staphylococcus aureus, 42% identity)
Expression and Regulation
Operons
genes
[gene|CB12BCCF6CEADC0C64DD918E0BAE4748E358A67B|mtnU]
description
[Pubmed|11545674]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12022921], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|CB12BCCF6CEADC0C64DD918E0BAE4748E358A67B|mtnU]

2021-10-21 13:01:43

ghost

8

034015902de08be359b609e5d8866361583a3a44

D1EE5AE42DBDB0F1C88B45E80BD75287AEB13F79

Biological materials
Mutant
MGNA-A784 (ykrU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/784 NBRP B. subtilis, Japan]
BKE13570 (Δ[gene|CB12BCCF6CEADC0C64DD918E0BAE4748E358A67B|mtnU]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTAACACCCCAAA,  downstream forward: _UP4_TAAAAAATATATTGACAACT
BKK13570 (Δ[gene|CB12BCCF6CEADC0C64DD918E0BAE4748E358A67B|mtnU]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTAACACCCCAAA,  downstream forward: _UP4_TAAAAAATATATTGACAACT
References
15102328,12022921,11545674,24837359

CB12BCCF6CEADC0C64DD918E0BAE4748E358A67B

Page visits: 1908

Time of last update: 2021-10-19 09:37:02

Author of last update: Melvin.boenninger