SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!



Molecular weight
29.25 kDa
Protein length
Gene length
methionine salvage
mtnU, ykrU

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0388

This gene is a member of the following regulons

1,424,767 → 1,425,546
Phenotypes of a mutant
reduced growth with 5-methylthioribose as single sulfur source [Pubmed|24837359]
The protein
Catalyzed reaction/ biological activity
2-ketoglutaramate + H2O --→ 2-oxoglutarate + NH3 [Pubmed|24837359]
Protein family
carbon-nitrogen hydrolase superfamily (with [protein|BDAA216E832B8EB267CED6456A0045254DD0E97D|yhcX], according to UniProt)
CN hydrolase (aa 3-238) (according to UniProt)
[PDB|3P8K] (from Staphylococcus aureus, 42% identity)
Expression and Regulation
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12022921], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2021-12-01 13:25:00





Biological materials
MGNA-A784 (ykrU::erm), available at the [ NBRP B. subtilis, Japan]
BKE13570 (Δ[gene|CB12BCCF6CEADC0C64DD918E0BAE4748E358A67B|mtnU]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTAACACCCCAAA,  downstream forward: _UP4_TAAAAAATATATTGACAACT
BKK13570 (Δ[gene|CB12BCCF6CEADC0C64DD918E0BAE4748E358A67B|mtnU]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTAACACCCCAAA,  downstream forward: _UP4_TAAAAAATATATTGACAACT


Page visits: 1974

Time of last update: 2022-01-23 17:56:42

Author of last update: Melvin.boenninger