SubtiWiki SubtiWiki
ssdC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ssdC
168

MucB/RseB-like protein, affects the assembly of the spore cortex adnd spore shape

locus
BSU_04630
Molecular weight
42.03 kDa
pI
9.6
Protein length
Gene length
function
assembly of the spore cortex
product
spore shape determinant C
essential
no
synonyms
ydcC

Genomic Context

Categories containing this gene/protein

This gene is a member of the following regulons

Gene
Coordinates
516,241 → 517,257
Phenotypes of a mutant
defect in sporulation [Pubmed|14523133]
some production of small spores, reduced [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG] activity [Pubmed|26735940]
forespores are rounder than those of the wild type [pubmed|33315869]
produces spores with an abnormal-looking cortex, abolishing cortex synthesis in the [gene|CA71F577FDBB8C6E647AA56E16E4111651F47E17|ssdC] mutant largely supresses the spore shape defect [pubmed|33315869]
The protein
[wiki|Domains]
N-terminal transmembrane segment and a large extracellular C-terminal-domain [pubmed|33315869]
Modification
phosphorylated on Thr-197 and Thr-201 [Pubmed|20509597]
[wiki|Localization]
cell membrane [pubmed|33315869]
forms a discontinuous, dynamic ring-like structure in the peripheral membrane of the mother cell, near the mother cell proximal pole of the forespore [pubmed|33315869]
localization depends on [protein|BBDA32A4EE3389D6F4404F7B3DA9E13AC7BF8055|spoVM], [protein|A25C1530DA7BB007A288E525404E9F775E219FE8|spoIVA], [protein|6698BB092E03BEF48AFD0CBF565410109CD1ABB5|spoVID], and [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|safA] [pubmed|33315869]
Expression and Regulation
Operons
genes
[gene|CA71F577FDBB8C6E647AA56E16E4111651F47E17|ssdC]
description
[pubmed|22383849]
regulation
expressed in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]) [Pubmed|15699190,12662922]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|CA71F577FDBB8C6E647AA56E16E4111651F47E17|ssdC]

2021-06-26 03:12:58

Jstuelk

3

99AFAFFBAB26395EE8B66048D86CCAF11B055324

5B5201DB5AEDC3650A94206880195DC691D5E971

Biological materials
Mutant
MGNA-C122 (ydcC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2120 NBRP B. subtilis, Japan]
BKE04630 (Δ[gene|CA71F577FDBB8C6E647AA56E16E4111651F47E17|ssdC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACCCCTTTTTCTCAATTG,  downstream forward: _UP4_TAACCGCCAAAGGCCAAACA
BKK04630 (Δ[gene|CA71F577FDBB8C6E647AA56E16E4111651F47E17|ssdC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTATGATAACCTCCTTT,  downstream forward: _UP4_TAGTCTGCATATTAGGGAAA
References
14523133,12662922,15699190,20509597,26735940,33315869

CA71F577FDBB8C6E647AA56E16E4111651F47E17

Page visits: 1643

Time of last update: 2021-09-18 21:45:18

Author of last update: Jstuelk