SubtiWiki SubtiWiki
cwlA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

cwlA
168

N-acetylmuramoyl-L-alanine amidase

locus
BSU_25900
Molecular weight
29.81 kDa
pI
10.4
Protein length
Gene length
function
minor autolysin
product
N-acetylmuramoyl-L-alanine amidase
essential
no
ec
3.5.1.28
synonyms
cwlA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5632

This gene is a member of the following regulons

Gene
Coordinates
2,664,573 → 2,665,391
The protein
Catalyzed reaction/ biological activity
Hydrolyzes the link between N-acetylmuramoyl residues and L-amino acid residues in certain cell-wall glycopeptides (according to UniProt)
Protein family
[wiki|N-acetylmuramoyl-L-alanine amidase 2 family] (according to UniProt)
[wiki|Domains]
contains an amidase_2 domain (like [protein|C1EB8D05386C1B35B8002239F5247CC6AB25F786|blyA], [protein|D5612882F1887BE342EF7072E71502382AB7289F|cwlH], [protein|50D7B97E4D3D41F74EF1942B85DE1DA4A33BEBB0|xlyA], [protein|A8AF827637B7208DFA101C9A2911BF9AB1AED08F|xlyB])
[wiki|N-acetylmuramoyl-L-alanine amidase domain] (aa 24-142) (according to UniProt)
Structure
[PDB|2L47] (from Bacillus phage Gamma, corresponds to the N-terminal domain, aa 3 ... 150, 61% identity)
Paralogous protein(s)
[protein|D5612882F1887BE342EF7072E71502382AB7289F|cwlH], [protein|50D7B97E4D3D41F74EF1942B85DE1DA4A33BEBB0|xlyA], [protein|A8AF827637B7208DFA101C9A2911BF9AB1AED08F|xlyB]
Biological materials
Mutant
BKE25900 (Δ[gene|C9C395A5F6A2C06EAC97F228C5C66D1628C937CF|cwlA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATACCCTCTCTCCTTCT,  downstream forward: _UP4_TAAATAAATAGTCTCCTTGA
BKK25900 (Δ[gene|C9C395A5F6A2C06EAC97F228C5C66D1628C937CF|cwlA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATACCCTCTCTCCTTCT,  downstream forward: _UP4_TAAATAAATAGTCTCCTTGA
References
1908396

C9C395A5F6A2C06EAC97F228C5C66D1628C937CF

Page visits: 1293

Time of last update: 2021-09-15 10:09:58

Author of last update: Melvin.boenninger