SubtiWiki SubtiWiki
frlB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

frlB
168

fructoselysine-6-P-glycosidase

locus
BSU_32610
Molecular weight
36.72 kDa
pI
5.44
Protein length
Gene length
function
metabolism of aminoacylated fructose
product
fructoselysine-6-P-glycosidase
essential
no
synonyms
frlB, yurP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2222

This gene is a member of the following regulons

Gene
Coordinates
3,351,110 3,352,096
The protein
[wiki|Domains]
2 [wiki|SIS domain]s (aa 15-153, aa 181-311) (according to UniProt)
Structure
[PDB|3EUA]
Modification
phosphorylated on Arg-48 [Pubmed|22517742]
[wiki|Localization]
membrane associated [Pubmed|18763711]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]-[gene|9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B|frlO]-[gene|8256CAAEC591E40A8CB172FF053E03BFFD5A4B54|frlN]-[gene|1F245030D0C81DC96FC0642199CA00579CF46D06|frlM]-[gene|C3823AFED3E5C3D1EA04C38D861239468C9E6349|frlD]-[gene|3B9331D6755B8253944AB33521BBF2B3EBA4CAEB|frlP]
description
[Pubmed|23175651,21347729,22383849]
regulation
'' [protein|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]'': repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]) [Pubmed|12618455]
induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR] [pubmed|30355672]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [pubmed|12618455], [pubmed|18083814], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|frlR]: repression, [Pubmed|21398478], in [regulon|protein:412A1DBBE7F87765DEBEEAAE02A047636A354D5E|frlR regulon]
[protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR]: unknown, [pubmed|30355672], in [regulon|protein:F4097349A563503468A2A14F062AEAC532C7917A|ylxR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [pubmed|22383849], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
the [gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]-[gene|9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B|frlO]-[gene|8256CAAEC591E40A8CB172FF053E03BFFD5A4B54|frlN]-[gene|1F245030D0C81DC96FC0642199CA00579CF46D06|frlM]-[gene|C3823AFED3E5C3D1EA04C38D861239468C9E6349|frlD]-[gene|3B9331D6755B8253944AB33521BBF2B3EBA4CAEB|frlP] operon is strongly downregulated in a [gene|search|cshA ]mutant [Pubmed|23175651]
Open in new tab

[gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]→[gene|3B9331D6755B8253944AB33521BBF2B3EBA4CAEB|frlP]

2021-09-10 15:51:43

Jstuelk

3

1386d0b18bc93ba0b08e1c36531a0379aa199ac3

218EAE44649CE3CDE2633AF97E4CC56ABC5AA2E3

genes
[gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]
description
[Pubmed|23175651]
regulation
'' [protein|search|frlB]'': repressed during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|12618455]
Open in new tab

[gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]

2021-08-06 20:54:56

ghost

2

6f545c025b50310a628d8db60a8df51a0ef7a4ce

DBAF12DE789DB131AB5059743664BD1CC1257D77

Biological materials
Mutant
MGNA-A594 (yurP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/594 NBRP B. subtilis, Japan]
BKE32610 ([gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATCCTTCACTCCTCGTT, downstream forward: _UP4_TGATCTGAAAATGAAGAACC
BKK32610 ([gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATCCTTCACTCCTCGTT, downstream forward: _UP4_TGATCTGAAAATGAAGAACC
References
22517742,23175651,21815947,15556630,18083814,12618455,21347729,18763711,21398478,15378759

C87E74FB67B53DD1C68916AA121388C60CE66E92

Page visits: 2277

Time of last update: 2021-09-14 01:24:07

Author of last update: Melvin.boenninger