SubtiWiki SubtiWiki
yaaL
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yaaL
168

unknown

locus
BSU_00220
Molecular weight
9.09 kDa
pI
10.33
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yaaL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
29,481 → 29,705
Expression and Regulation
Operons
genes
[gene|73D063EDC412F7F28DA27C986ECCCD1C4A1F6618|dnaX]-[gene|9AFCEFE83560B1E2B1FFD7CFD2E4F17FAE137889|yaaK]-[gene|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|recR]-[gene|C5127208E7562F09249112240F0BE8C582B2E5AD|yaaL]-[gene|CB5D3A2E5BEE336539BEB2D7C5D9C3A63C78FD01|bofA]
description
[Pubmed|22383849]
Open in new tab

[gene|73D063EDC412F7F28DA27C986ECCCD1C4A1F6618|dnaX]→[gene|CB5D3A2E5BEE336539BEB2D7C5D9C3A63C78FD01|bofA]

2021-09-11 03:51:47

Jstuelk

12

1a32cdecddaee24171f48459041fdcb062bafc36

7EC4B7D4D9D0E5E8848420FD5562059E4207233C

Biological materials
Mutant
MGNA-B893 (yaaL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1892 NBRP B. subtilis, Japan]
BKE00220 (Δ[gene|C5127208E7562F09249112240F0BE8C582B2E5AD|yaaL]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ACCCATGGATCGCTTTTTCC,  downstream forward: _UP4_TAAGTGGTCTAAACTCCTGG
BKK00220 (Δ[gene|C5127208E7562F09249112240F0BE8C582B2E5AD|yaaL]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ACCCATGGATCGCTTTTTCC,  downstream forward: _UP4_TAAGTGGTCTAAACTCCTGG

C5127208E7562F09249112240F0BE8C582B2E5AD

Page visits: 818

Time of last update: 2021-09-17 08:11:21

Author of last update: Bzhu