SubtiWiki SubtiWiki
cotQ

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

cotQ
168

outer spore coat protein

locus
BSU_34520
Molecular weight
49.92 kDa
pI
6.1
Protein length
Gene length
function
protection of the spore
product
spore coat protein
essential
no
synonyms
cotQ, yvdP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0277

This gene is a member of the following regulons

Gene
Coordinates
3,542,943 → 3,544,286
The protein
Protein family
oxygen-dependent FAD-linked oxidoreductase family (with [protein|23F2385D14DDD5C400DC897E0F0FC814ACFC36B8|yitY] and [protein|11499CDC836A40E857B8F5AD746BA2C650DC916B|ygaK], according to UniProt)
[wiki|Domains]
[wiki|FAD-binding PCMH-type domain] (aa 29-201) (according to UniProt)
[wiki|Cofactors]
FAD (according to UniProt)
Structure
[PDB|3W8W] (EncM from Streptomyces maritimus, 32% identity) [pubmed|24162851]
Paralogous protein(s)
[protein|11499CDC836A40E857B8F5AD746BA2C650DC916B|ygaK], (40%)
[wiki|Localization]
outer spore coat, localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|cotE]  [Pubmed|22171814]
Expression and Regulation
Operons
genes
[gene|C4CC3772CA9FC46D90D2F15AE261106A0BC4453C|cotQ]
description
[Pubmed|12480901]
regulation
expressed late during sporulation ([protein|search|SigG], [protein|search|SigK], [protein|search|GerE]) [Pubmed|15383836,15699190,12480901]
regulatory mechanism
[protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]: activation, [Pubmed|15383836], in [regulon|protein:19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE regulon]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|15699190], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|12480901], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|C4CC3772CA9FC46D90D2F15AE261106A0BC4453C|cotQ]

2021-11-04 21:52:36

ghost

10

6612c78f29fe73761013dd98636ad0989247c30c

E8FB92E3109446E08BBE85E8756F3DE2CA1C0CC4

Biological materials
Mutant
MGNA-B620 (yvdP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1619 NBRP B. subtilis, Japan]
BKE34520 (Δ[gene|C4CC3772CA9FC46D90D2F15AE261106A0BC4453C|cotQ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATATTATTTCACTCCCA,  downstream forward: _UP4_TAAAGTTTATTAAAGACAGA
BKK34520 (Δ[gene|C4CC3772CA9FC46D90D2F15AE261106A0BC4453C|cotQ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATATTATTTCACTCCCA,  downstream forward: _UP4_TAAAGTTTATTAAAGACAGA
References
12562816,15699190,12480901,22171814,15383836,28870294,24162851

C4CC3772CA9FC46D90D2F15AE261106A0BC4453C

Page visits: 1369

Time of last update: 2021-11-25 14:25:41

Author of last update: Melvin.boenninger