SubtiWiki SubtiWiki
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


outer spore coat protein

Molecular weight
49.92 kDa
Protein length
Gene length
protection of the spore
spore coat protein
cotQ, yvdP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0277

This gene is a member of the following regulons

3,542,943 → 3,544,286
The protein
Protein family
oxygen-dependent FAD-linked oxidoreductase family (with [protein|23F2385D14DDD5C400DC897E0F0FC814ACFC36B8|yitY] and [protein|11499CDC836A40E857B8F5AD746BA2C650DC916B|ygaK], according to UniProt)
[wiki|FAD-binding PCMH-type domain] (aa 29-201) (according to UniProt)
FAD (according to UniProt)
[PDB|3W8W] (EncM from Streptomyces maritimus, 32% identity) [pubmed|24162851]
Paralogous protein(s)
[protein|11499CDC836A40E857B8F5AD746BA2C650DC916B|ygaK], (40%)
outer spore coat, localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|cotE]  [Pubmed|22171814]
Expression and Regulation
expressed late during sporulation ([protein|search|SigG], [protein|search|SigK], [protein|search|GerE]) [Pubmed|15383836,15699190,12480901]
regulatory mechanism
[protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]: activation, [Pubmed|15383836], in [regulon|protein:19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE regulon]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|15699190], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|12480901], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab


2021-09-13 17:24:21





Biological materials
MGNA-B620 (yvdP::erm), available at the [ NBRP B. subtilis, Japan]
BKE34520 (Δ[gene|C4CC3772CA9FC46D90D2F15AE261106A0BC4453C|cotQ]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATATTATTTCACTCCCA,  downstream forward: _UP4_TAAAGTTTATTAAAGACAGA
BKK34520 (Δ[gene|C4CC3772CA9FC46D90D2F15AE261106A0BC4453C|cotQ]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATATTATTTCACTCCCA,  downstream forward: _UP4_TAAAGTTTATTAAAGACAGA


Page visits: 1332

Time of last update: 2021-09-15 10:26:22

Author of last update: Melvin.boenninger