SubtiWiki SubtiWiki
melE
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

melE
168

subunit of [wiki|ABC transporter] for melibiose and raffinose (binding lipoprotein)

locus
BSU_30270
Molecular weight
48.07 kDa
pI
5.85
Protein length
Gene length
function
uptake of melibiose and raffinose
product
[wiki|ABC transporter] (binding protein)
essential
no
synonyms
melE, msmE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1653

This gene is a member of the following regulons

Gene
Coordinates
3,097,850 → 3,099,130
The protein
Catalyzed reaction/ biological activity
binding of melibiose and raffinose [pubmed|31138628]
Protein family
[wiki|Bacterial solute-binding protein 1 family] (according to UniProt)
Structure
[PDB|4R6H]
[wiki|Localization]
extracellular (signal peptide), associated to the cell membrane (via [protein|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[protein|05BFEA711D82395A55B505E5A38286BE2F570350|melD]) [Pubmed|18957862,10092453]
Expression and Regulation
Operons
genes
[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]
description
[Pubmed|22383849]
regulation
repressed by glucose ([protein|search|CcpA]) [Pubmed|22900538]
Open in new tab

[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]→[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]

2021-08-14 20:11:04

ghost

4

847594f17f75304119fc4e01c75357cb3be0099d

6C880CEB4C8A523152A9E2F2B771FB0BEA14B117

genes
[gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]-[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]
description
[Pubmed|22383849]
regulation
repressed by glucose ([protein|search|CcpA]) [Pubmed|22900538]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|22900538], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]: repression, [pubmed|31138628], in [regulon|protein:58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|22900538,31138628], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]→[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]

2021-09-17 05:16:53

ghost

2

a76a3bd8bbf487172d83c078a68b2450f4f95213

AB0F662445BB81BBCFC1971F2E98536D4BBE6D03

Biological materials
Mutant
MGNA-A801 (msmE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/801 NBRP B. subtilis, Japan]
BKE30270 (Δ[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30270 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTCCTCCTTATCAT,  downstream forward: _UP4_TCCGAAACACAGGGAGCTGA
BKK30270 (Δ[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30270 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTCCTCCTTATCAT,  downstream forward: _UP4_TCCGAAACACAGGGAGCTGA
References
10092453,22383849,22900538,18957862,31138628

C3D7C64AD0E58BF326257E23136466A237138B50

Page visits: 1266

Time of last update: 2021-09-14 23:55:13

Author of last update: Jstuelk