SubtiWiki SubtiWiki
putR
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

putR
168

transcriptional activator of the proline utilization operon [gene|1F548515402950572E7212901729B2480432D1B9|putB]-[gene|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]-[gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP]

locus
BSU_03230
Molecular weight
47.67 kDa
pI
5.37
Protein length
Gene length
function
regulation of proline utilization
product
transcriptional activator ([wiki|PucR family])
essential
no
synonyms
putR, ycgP, prcR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2508

This gene is a member of the following regulons

Gene
Coordinates
348,724 → 349,959
Phenotypes of a mutant
no growth with proline as single source of carbon or nitrogen [Pubmed|21840319]
The protein
Catalyzed reaction/ biological activity
transcription activation of the proline utilization operon ''[gene|1F548515402950572E7212901729B2480432D1B9|putB]-[gene|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]-[gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP]'' in the presence of proline  [Pubmed|21840319,21964733]
Protein family
[wiki|PucR family]
[wiki|CdaR family] (according to UniProt)
[wiki|Cofactors]
proline acts as co-activator  [Pubmed|21840319]
Effectors of protein activity
proline activates PutR  [Pubmed|21840319]
Expression and Regulation
Operons
genes
[gene|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR]
description
[Pubmed|21840319]
regulation
constitutively expressed [Pubmed|21840319,21964733]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|21964733], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR]

2021-09-05 00:50:55

ghost

1

362880cde7c5582e54923894d48cb82e03ad2a79

348E344031F35926B4894FD90B2F61B36D555EE6

Biological materials
Mutant
BKE03230 (Δ[gene|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACCTTTTTCTCCTATAC,  downstream forward: _UP4_TAAAAAAGAAACCAGTACTT
BKK03230 (Δ[gene|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACCTTTTTCTCCTATAC,  downstream forward: _UP4_TAAAAAAGAAACCAGTACTT
References
21840319,21964733,22139509

C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE

Page visits: 1850

Time of last update: 2021-09-11 11:33:05

Author of last update: Melvin.boenninger