SubtiWiki SubtiWiki
hisF

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

hisF
168

imidazole glycerol phosphate synthase (synthase subunit)

locus
BSU_34870
Molecular weight
27.14 kDa
pI
5.24
Protein length
Gene length
function
biosynthesis of histidine
product
imidazole glycerol phosphate synthase (synthase subunit)
essential
no
synonyms
hisF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0107

This gene is a member of the following regulons

Gene
Coordinates
3,583,562 3,584,320
The protein
Catalyzed reaction/ biological activity
5-[(5-phospho-1-deoxy-D-ribulos-1-ylimino)methylamino]-1-(5-phospho--D-ribosyl)imidazole-4-carboxamide + L-glutamine --> 5-amino-1-(5-phospho--D-ribosyl)imidazole-4-carboxamide + D-erythro-1-(imidazol-4-yl)glycerol 3-phosphate + H+ + L-glutamate (according to UniProt)
Protein family
HisA/HisF family (with [protein|148F0C7983250F50676D234DB713E532AA55DDBF|hisA], according to UniProt)
Structure
[PDB|1KA9] (the [protein|C22C15754859B2510E52622E6A5DFAF97A7AD4E5|hisF]-[protein|DEB3122A3EA36545759FAA6F86F71F971CA5F011|hisH] complex from ''Thermus thermophilus'', 59% identity) [Pubmed|12417026]
Paralogous protein(s)
[protein|148F0C7983250F50676D234DB713E532AA55DDBF|hisA]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|E8FD92F48BE16F87D7481262F4E49003A78DE78F|hisZ]-[gene|183C8B4F28E601D670B3D997D333AF2B5C4A4759|hisG]-[gene|03274B80B2DFE0A2939981B0E0CB8C34A9B0B102|hisD]-[gene|88ED20DFEBD5D7B985F99D4494142FBA699A1E91|hisB]-[gene|DEB3122A3EA36545759FAA6F86F71F971CA5F011|hisH]-[gene|148F0C7983250F50676D234DB713E532AA55DDBF|hisA]-[gene|C22C15754859B2510E52622E6A5DFAF97A7AD4E5|hisF]-[gene|5C84CA2A9E22173E144F519389F545F107A267D9|hisI]
description
[Pubmed|12107147]
regulation
expression during spore [wiki|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
expression depends on functional [protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR] [pubmed|30355672]
regulatory mechanism
[protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR]: unknown, [pubmed|30355672], in [regulon|protein:F4097349A563503468A2A14F062AEAC532C7917A|ylxR regulon]
Open in new tab

[gene|E8FD92F48BE16F87D7481262F4E49003A78DE78F|hisZ]→[gene|5C84CA2A9E22173E144F519389F545F107A267D9|hisI]

2021-11-11 00:25:13

Jstuelk

16

896e17f5309df81d9427f38fec175515ad428723

B6AAF7601668444EDDC2FE084A87885740B98ACD

Biological materials
Mutant
BKE34870 ([gene|C22C15754859B2510E52622E6A5DFAF97A7AD4E5|hisF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCATGGGATAATCCGTTTTG, downstream forward: _UP4_AAAGAGTACGGGGTGAATGT
BKK34870 ([gene|C22C15754859B2510E52622E6A5DFAF97A7AD4E5|hisF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCATGGGATAATCCGTTTTG, downstream forward: _UP4_AAAGAGTACGGGGTGAATGT
References
Reviews
12859215
Original Publications
12107147,15378759,12417026,27766092

C22C15754859B2510E52622E6A5DFAF97A7AD4E5

Page visits: 2156

Time of last update: 2021-11-03 12:24:02

Author of last update: Melvin.boenninger