SubtiWiki SubtiWiki
rbsK

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

rbsK
168

ribokinase

locus
BSU_35920
Molecular weight
30.99 kDa
pI
4.61
Protein length
Gene length
function
ribose utilization
product
ribokinase
essential
no
ec
2.7.1.15
synonyms
rbsK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0524

This gene is a member of the following regulons

Gene
Coordinates
3,702,393 → 3,703,274
The protein
Catalyzed reaction/ biological activity
ATP + D-ribose --> ADP + D-ribose 5-phosphate + H+ (according to UniProt)
Protein family
[wiki|carbohydrate kinase PfkB family] (according to UniProt)
Structure
[PDB|1VM7] (the enzyme of ''Thermotoga maritima'', 38% identity)
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]-[gene|C229BD2C00B169CF4A99482E65B3F749AD9D51D8|rbsK]-[gene|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|rbsD]-[gene|AB4A686F62550F90F5BD8D27DAADC9C33F1DA1DB|rbsA]-[gene|F1258E31151E137A850811B0C851D473CEFFD43B|rbsC]-[gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]
description
[Pubmed|7921236]
regulation
expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|7592460]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|7921236], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: activation, [Pubmed|7592460], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7511775], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]→[gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]

2021-10-17 09:36:50

ghost

8

ecd23e67fb36c12e46381b0bbd805e52a3ac9a7b

9A76230F5BF071D52DFA7084300C0507E658DAA8

Biological materials
Mutant
BKE35920 (Δ[gene|C229BD2C00B169CF4A99482E65B3F749AD9D51D8|rbsK]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ACCAATCACACAAATATTAC,  downstream forward: _UP4_AATGAAGTAGAGGAGCTGCT
BKK35920 (Δ[gene|C229BD2C00B169CF4A99482E65B3F749AD9D51D8|rbsK]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ACCAATCACACAAATATTAC,  downstream forward: _UP4_AATGAAGTAGAGGAGCTGCT
References
16872404,7511775,7592460,7921236

C229BD2C00B169CF4A99482E65B3F749AD9D51D8

Page visits: 1473

Time of last update: 2021-10-16 21:33:05

Author of last update: Melvin.boenninger