SubtiWiki SubtiWiki
gapB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

gapB
168

glyceraldehyde-3-phosphate dehydrogenase, NADP-dependent, gluconeogenic enzyme, forms a transhydrogenation cycle with GapA for balancing of NADPH

locus
BSU_29020
Molecular weight
37.32 kDa
pI
6.45
Protein length
Gene length
function
anabolic enzyme in gluconeogenesis
product
glyceraldehyde-3-phosphate dehydrogenase 2
essential
no
ec
1.2.1.59
synonyms
gapB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0057

This gene is a member of the following regulons

Gene
Coordinates
2,967,032 → 2,968,054
Phenotypes of a mutant
inactivation of ''[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]'' reduces sporulation efficiency to 0.3% that of wild type cells; delayed entry into sporulation and fewer sporulating cells [Pubmed|26735940]
The protein
Catalyzed reaction/ biological activity
D-glyceraldehyde 3-phosphate + NADP+ + phosphate --> 3-phospho-D-glyceroyl phosphate + H+ + NADPH(according to UniProt)
D-glyceraldehyde 3-phosphate + NAD+ + phosphate --> 3-phospho-D-glyceroyl phosphate + H+ + NADH (according to UniProt)
This reaction is part of the gluconeogenesis
Protein family
glyceraldehyde-3-phosphate dehydrogenase family (with [protein|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA], according to UniProt)
[wiki|Domains]
Nucleotid bindinge domain (12-13)
2x Glyceraldehyde 3-phosphate binding domain (151-153) & (210-211)
[wiki|Cofactors]
NADP+ (preferentially) and NAD+ [Pubmed|10799476]
Structure
[PDB|3PRL] (from ''B. halodurans'')
Kinetic information
Michaelis-Menten [Pubmed|10799476]
Paralogous protein(s)
[protein|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA]
[wiki|Localization]
Cytoplasm (Homogeneous) [Pubmed|16479537]
Expression and Regulation
Operons
genes
[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]-[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]
description
[Pubmed|15720552]
regulation
[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]: repressed in the presence of glucose ([protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]) [Pubmed|15720552]
regulatory mechanism
[protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]: repression, [Pubmed|15720552], in [regulon|protein:2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15720552], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]: the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the monocistronic [gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD] mRNA increases from 1.4 to 36 min) [PubMed|21815947]
Open in new tab

[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]→[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]

2021-09-12 03:26:38

Jstuelk

7

FD19E158AAF06F7ED8F02CFEE19CA4A6483E5FCD

2E200F04B473223099E032055E071DE51C38D7C2

Biological materials
Mutant
MGNA-A121 (gapB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/121 NBRP B. subtilis, Japan]
GP701 (''gapB''::''spec''), available in [wiki|Stülke] lab
1A1004 ( ''gapB''::''erm''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1004&Search=1A1004 BGSC]
BKE29020 (Δ[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29020 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTGGACACCCCTTATC,  downstream forward: _UP4_TAAAATAAGGTCATGGACAC
BKK29020 (Δ[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29020 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTGGACACCCCTTATC,  downstream forward: _UP4_TAAAATAAGGTCATGGACAC
labs
[wiki|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
References
16479537,10799476,10844697,15720552,18586936,17114254,22190493,23033921,22740702,26735940,28760849

C1B89BD3DD27CD566018558D3A7845FB451056F0

Page visits: 3595

Time of last update: 2021-09-15 19:44:00

Author of last update: Melvin.boenninger