SubtiWiki SubtiWiki
gapB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

gapB
168

glyceraldehyde-3-phosphate dehydrogenase, NADP-dependent, gluconeogenic enzyme, forms a transhydrogenation cycle with GapA for balancing of NADPH

locus
BSU_29020
Molecular weight
37.32 kDa
pI
6.45
Protein length
Gene length
function
anabolic enzyme in gluconeogenesis
product
glyceraldehyde-3-phosphate dehydrogenase 2
essential
no
ec
1.2.1.59
synonyms
gapB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0057

This gene is a member of the following regulons

Gene
Coordinates
2,967,032 → 2,968,054
Phenotypes of a mutant
inactivation of ''[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]'' reduces sporulation efficiency to 0.3% that of wild type cells; delayed entry into sporulation and fewer sporulating cells [Pubmed|26735940]
The protein
Catalyzed reaction/ biological activity
D-glyceraldehyde 3-phosphate + NADP+ + phosphate --> 3-phospho-D-glyceroyl phosphate + H+ + NADPH(according to UniProt)
D-glyceraldehyde 3-phosphate + NAD+ + phosphate --> 3-phospho-D-glyceroyl phosphate + H+ + NADH (according to UniProt)
This reaction is part of the gluconeogenesis
Protein family
glyceraldehyde-3-phosphate dehydrogenase family (with [protein|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA], according to UniProt)
[wiki|Domains]
Nucleotid bindinge domain (12-13)
2x Glyceraldehyde 3-phosphate binding domain (151-153) & (210-211)
[wiki|Cofactors]
NADP+ (preferentially) and NAD+ [Pubmed|10799476]
Structure
[PDB|3PRL] (from ''B. halodurans'')
Kinetic information
Michaelis-Menten [Pubmed|10799476]
Paralogous protein(s)
[protein|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA]
[wiki|Localization]
Cytoplasm (Homogeneous) [Pubmed|16479537]
Expression and Regulation
Operons
genes
[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]-[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]
description
[Pubmed|15720552]
regulation
[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]: repressed in the presence of glucose ([protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]) [Pubmed|15720552]
regulatory mechanism
[protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]: repression, [Pubmed|15720552], in [regulon|protein:2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15720552], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]: the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the monocistronic [gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD] mRNA increases from 1.4 to 36 min) [PubMed|21815947]
Open in new tab

[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]→[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]

2021-10-31 02:56:50

Jstuelk

14

FD19E158AAF06F7ED8F02CFEE19CA4A6483E5FCD

2E200F04B473223099E032055E071DE51C38D7C2

Biological materials
Mutant
MGNA-A121 (gapB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/121 NBRP B. subtilis, Japan]
GP701 (''gapB''::''spec''), available in [wiki|Stülke] lab
1A1004 ( ''gapB''::''erm''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1004&Search=1A1004 BGSC]
BKE29020 (Δ[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29020 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTGGACACCCCTTATC,  downstream forward: _UP4_TAAAATAAGGTCATGGACAC
BKK29020 (Δ[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29020 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTGGACACCCCTTATC,  downstream forward: _UP4_TAAAATAAGGTCATGGACAC
lacZ fusion
pGP3312 (pgapB-lacZ cat), GP1679, available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
References
16479537,10799476,10844697,15720552,18586936,17114254,22190493,23033921,22740702,26735940,28760849

C1B89BD3DD27CD566018558D3A7845FB451056F0

Page visits: 3641

Time of last update: 2021-12-03 15:25:47

Author of last update: Jstuelk