SubtiWiki SubtiWiki
msrB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

msrB
168

peptide methionine sulfoxide reductase

locus
BSU_21680
Molecular weight
16.46 kDa
pI
5.84
Protein length
Gene length
function
regeneration of methionine and restoration of protein function after oxidative damage
product
peptide methionine sulfoxide reductase
ec
1.8.4.12
synonyms
msrB, yppQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0229

This gene is a member of the following regulons

Gene
Coordinates
2,287,097 → 2,287,528
The protein
Catalyzed reaction/ biological activity
[thioredoxin]-disulfide + H2O + L-methionyl-[protein] --> [thioredoxin]-dithiol + L-methionyl-(R)-S-oxide-[protein] (according to UniProt)
Protein family
MsrB Met sulfoxide reductase family (single member, according to UniProt)
[wiki|Domains]
MsrB domain (aa 5-126) (according to UniProt)
Structure
[PDB|1XM0]
Expression and Regulation
Operons
genes
[gene|389245FDE13226D65DF117E28B5DA346DC856860|msrA]-[gene|BF8A3C916C4B673D30AEF7C330C9BD5A487AB0EA|msrB]
description
[Pubmed|18662407]
regulation
induced by oxidative stress ([protein|search|Spx])
regulatory mechanism
[protein|2C6386E9A63F410558D168798D077DF91590F454|spx]: activation, oxidized [protein|2C6386E9A63F410558D168798D077DF91590F454|spx] binds [protein|5996A5C25E108A3C4562686BF34A59CB14FD56EB|rpoA] and enhances [protein|389245FDE13226D65DF117E28B5DA346DC856860|msrA]-[protein|BF8A3C916C4B673D30AEF7C330C9BD5A487AB0EA|msrB] operon transcription [Pubmed|18662407], in [regulon|protein:2C6386E9A63F410558D168798D077DF91590F454|spx regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|18662407,17289755], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|389245FDE13226D65DF117E28B5DA346DC856860|msrA]→[gene|BF8A3C916C4B673D30AEF7C330C9BD5A487AB0EA|msrB]

2021-07-24 16:47:34

ghost

1

260530b389542edd9065dae32bb081f8ff5b9af0

31A91806DA37296DA2E76252C321BA878BFF3D0A

Biological materials
Mutant
MGNA-A905 (yppQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/905 NBRP B. subtilis, Japan]
BKE21680 (Δ[gene|BF8A3C916C4B673D30AEF7C330C9BD5A487AB0EA|msrB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTTCTTCTTTATTGTACG,  downstream forward: _UP4_TAAACTGTTAAAAACAGGCC
BKK21680 (Δ[gene|BF8A3C916C4B673D30AEF7C330C9BD5A487AB0EA|msrB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTTCTTCTTTATTGTACG,  downstream forward: _UP4_TAAACTGTTAAAAACAGGCC
References
18662407

BF8A3C916C4B673D30AEF7C330C9BD5A487AB0EA

Page visits: 1161

Time of last update: 2021-09-08 15:33:16

Author of last update: Melvin.boenninger