SubtiWiki SubtiWiki
sscA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sscA
168

small spore protein

locus
BSU_09958
Molecular weight
2.98 kDa
pI
5.274
Protein length
Gene length
function
spore coat assembly
product
small spore protein
essential
no
synonyms
sscA, yhzE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,071,402 → 1,071,488
Phenotypes of a mutant
poor [wiki|germination]
The protein
Protein family
[wiki|SscA family] (according to UniProt)
Expression and Regulation
Operons
genes
[gene|BF6DA9F822CB6AC907E53BC8745D411245827820|sscA]
description
[Pubmed|21670523]
regulation
expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|21670523]
regulatory mechanism
[protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]: activation, [Pubmed|21670523], in [regulon|protein:19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE regulon]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|21670523], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab

[gene|BF6DA9F822CB6AC907E53BC8745D411245827820|sscA]

2020-11-06 12:56:32

ghost

0

df516b4e82ea2126fa3f64ff963f34b07ee74d38

50D2C7948A9F49D31BA190D9515FACC76DD855B1

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
BKE09958 (Δ[gene|BF6DA9F822CB6AC907E53BC8745D411245827820|sscA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09958 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTACATACCTCCTTTT,  downstream forward: _UP4_TAAGCAGCCCGAGGATCGCT
BKK09958 (Δ[gene|BF6DA9F822CB6AC907E53BC8745D411245827820|sscA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09958 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTACATACCTCCTTTT,  downstream forward: _UP4_TAAGCAGCCCGAGGATCGCT
References
20156992,21670523,30782632

BF6DA9F822CB6AC907E53BC8745D411245827820

Page visits: 1170

Time of last update: 2021-09-13 13:58:17

Author of last update: Melvin.boenninger