SubtiWiki SubtiWiki
ypzF

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ypzF
168

unknown

locus
BSU_22019
Molecular weight
5.40 kDa
pI
10.371
Protein length
Gene length
function
unknown
product
unknown
essential
-
synonyms
ypzF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,311,986 → 2,312,132
Expression and Regulation
Operons
genes
[gene|9899D0CC5FF530A48532A653075494686796564D|ypbS]-[gene|BD8D1EBA85928C4ECA4FF50556FC7C59F9BC0E9D|ypzF]
description
[Pubmed|22383849]
Open in new tab

[gene|9899D0CC5FF530A48532A653075494686796564D|ypbS]→[gene|BD8D1EBA85928C4ECA4FF50556FC7C59F9BC0E9D|ypzF]

2020-11-06 12:56:32

Jstuelk

0

77ab35bea65ff9df45c7f7edd96f10e2cd11e2da

5595AA8076BC0BA6806B4AA288AC44C2956E5002

genes
[gene|22F930B371A833BAEA84B32FADBB2BBA0B91A53B|dynA]-[gene|9899D0CC5FF530A48532A653075494686796564D|ypbS]-[gene|BD8D1EBA85928C4ECA4FF50556FC7C59F9BC0E9D|ypzF]
description
[Pubmed|22383849]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8396117], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|22F930B371A833BAEA84B32FADBB2BBA0B91A53B|dynA]-[gene|9899D0CC5FF530A48532A653075494686796564D|ypbS]-[gene|BD8D1EBA85928C4ECA4FF50556FC7C59F9BC0E9D|ypzF]

2021-10-21 00:19:57

Jstuelk

3

177c48e99b386e3cd1a27a0260b3babda43f9eec

615EF1D03BA787E7836A11D5ED69226719C562D0

genes
[gene|BD8D1EBA85928C4ECA4FF50556FC7C59F9BC0E9D|ypzF]
description
[Pubmed|22383849]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [pubmed|30782632], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|BD8D1EBA85928C4ECA4FF50556FC7C59F9BC0E9D|ypzF]

2021-08-04 17:35:57

Jstuelk

3

b3b4fb8a5e1c6d3ecf1aa48b8b98a246247435c4

B76DEA11BDAD57CF1F4750BB27B4E9AF303A1BAE

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
BKE22019 (Δ[gene|BD8D1EBA85928C4ECA4FF50556FC7C59F9BC0E9D|ypzF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22019 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAATCCCCCCTTACGTC,  downstream forward: _UP4_TGATAAATATTCAAACAGTA
BKK22019 (Δ[gene|BD8D1EBA85928C4ECA4FF50556FC7C59F9BC0E9D|ypzF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22019 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAATCCCCCCTTACGTC,  downstream forward: _UP4_TGATAAATATTCAAACAGTA
References
Research papers
30782632

BD8D1EBA85928C4ECA4FF50556FC7C59F9BC0E9D

Page visits: 612

Time of last update: 2021-10-19 02:21:48

Author of last update: Jstuelk