SubtiWiki SubtiWiki
yodC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yodC
168

NADH oxidase

locus
BSU_19550
Molecular weight
22.19 kDa
pI
5.27
Protein length
Gene length
function
regeneration of NAD from NADH
product
NADH oxidase
essential
no
synonyms
yodC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0778

This gene is a member of the following regulons

Gene
Coordinates
2,127,813 → 2,128,421
The protein
Catalyzed reaction/ biological activity
regeneration of NAD from NADH [Pubmed|26312069]
Protein family
[wiki|nitroreductase family] (according to UniProt)
Structure
[PDB|3GE6] (from '' Exiguobacterium sibiricum'', 42% identity)
Expression and Regulation
Operons
genes
[gene|BC434FE0E92376A618ED34ACBB07B8A2E7F31DE6|yodC]
description
[pubmed|22383849]
regulatory mechanism
[protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|yodB]: repression, [Pubmed|18208493], in [regulon|protein:73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|yodB regulon]
Open in new tab

[gene|BC434FE0E92376A618ED34ACBB07B8A2E7F31DE6|yodC]

2021-07-09 22:30:33

Bzhu

3

6835af8714fe24eee6cdc4e7445502f63396506b

FC7E992FE26E5E30AAED8920F8861D7BDB01BCE0

Biological materials
Mutant
MGNA-B434 (yodC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1433 NBRP B. subtilis, Japan]
BKE19550 (Δ[gene|BC434FE0E92376A618ED34ACBB07B8A2E7F31DE6|yodC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGTGTTTCCTCCTTCGG,  downstream forward: _UP4_TAAGGATATGAAAAACCTTA
BKK19550 (Δ[gene|BC434FE0E92376A618ED34ACBB07B8A2E7F31DE6|yodC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGTGTTTCCTCCTTCGG,  downstream forward: _UP4_TAAGGATATGAAAAACCTTA
References
17407181,18208493,26312069

BC434FE0E92376A618ED34ACBB07B8A2E7F31DE6

Page visits: 1109

Time of last update: 2021-09-01 15:01:37

Author of last update: Melvin.boenninger