SubtiWiki SubtiWiki
yngJ
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yngJ
168

3-methylbutanoyl-CoA dehydrogenase

locus
BSU_18260
Molecular weight
40.76 kDa
pI
5.79
Protein length
Gene length
function
mother cell metabolism, leucine utilization
product
3-methylbutanoyl-CoA dehydrogenase
essential
no
ec
1.3.99.10
synonyms
yngJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1960

This gene is a member of the following regulons

Gene
Coordinates
1,956,218 → 1,957,360
The protein
Catalyzed reaction/ biological activity
3-methylbutanoyl-CoA  -→ 3-methylbut-2-enoyl-CoA [Pubmed|19935659]
A + 2,3-saturated acyl-CoA --> 2,3-dehydroacyl-CoA + AH2 (according to UniProt)
Protein family
[wiki|Acyl-CoA dehydrogenase family] (according to UniProt)
[wiki|Cofactors]
FAD (according to UniProt)
Structure
[PDB|3OWA] (from ''B. anthracis'', 37% identity, 54% similarity)
Paralogous protein(s)
[protein|F25CDDEBAFC72036664323619F5197D45E86BE9A|mmgC], [protein|7D89BBB52403BF99416250688EFA90C2BE8EB591|acdA], [protein|B5325CBF1408E2CA227EB462092E209F4C87E797|fadE]
Expression and Regulation
Operons
genes
[gene|BA28DFBAF88A4994B0541D1FF2187312FDE1FA15|yngJ]-[gene|5F73ACDEAFC7F1EB26D55195100C3283FC1F587C|yngI]-[gene|CAF58B4BAEB03353CF80A2862590888D07B48E2C|yngH]-[gene|1FBF1512C28BCE04E7D51247D94DC88C72FBFF07|yngHB]-[gene|EEEE69A98DFAA3327FBC04F1422E959D8B44AF20|yngG]-[gene|D5CCFDE9312909B7E5B98876794569357791C76B|yngF]-[gene|2192474E13EAF6D2CF97CB957864FC89ED0118E0|yngE]
description
[Pubmed|12662922]
regulation
expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,12662922]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|BA28DFBAF88A4994B0541D1FF2187312FDE1FA15|yngJ]→[gene|2192474E13EAF6D2CF97CB957864FC89ED0118E0|yngE]

2021-09-18 17:56:53

ghost

7

ec5ff58c486f073be542df6cbb7bc2ebb4e5deee

AC16F1F9497F11969688D82F5CC45D78083A44DD

Biological materials
Mutant
BKE18260 (Δ[gene|BA28DFBAF88A4994B0541D1FF2187312FDE1FA15|yngJ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACATCGTTTCCTCCTTCAC,  downstream forward: _UP4_TAAAAATGTAAACGCTTTCC
BKK18260 (Δ[gene|BA28DFBAF88A4994B0541D1FF2187312FDE1FA15|yngJ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACATCGTTTCCTCCTTCAC,  downstream forward: _UP4_TAAAAATGTAAACGCTTTCC
References
15699190,12662922,19935659

BA28DFBAF88A4994B0541D1FF2187312FDE1FA15

Page visits: 1254

Time of last update: 2021-09-13 18:54:42

Author of last update: Melvin.boenninger