SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


rRNA methyltransferase

Molecular weight
51.65 kDa
Protein length
Gene length
23S rRNA maturation
rRNA methyltransferase
rlmCD, yerS, yefA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2265

This gene is a member of the following regulons

737,603 → 738,982
The protein
Catalyzed reaction/ biological activity
methylation of U747 and U1939 in 23S rRNA [Pubmed|21824914]
S-adenosyl-L-methionine + uridine747 in 23S rRNA --> 5-methyluridine747 in 23S rRNA + H+ + S-adenosyl-L-homocysteine (according to UniProt)
S-adenosyl-L-methionine + uridine1939 in 23S rRNA --> 5-methyluridine1939 in 23S rRNA + H+ + S-adenosyl-L-homocysteine (according to UniProt)
Protein family
[wiki|Methyltransferase superfamily] (according to UniProt)
[wiki|class I-like SAM-binding methyltransferase superfamily] (according to UniProt)
[wiki|TRAM domain] (aa 6-64) (according to UniProt)
Fe-S cluster [pubmed|29292548]
[PDB|2BH2] (from ''E. coli'', 32% identity) [Pubmed|15766524]
Paralogous protein(s)
Expression and Regulation
Open in new tab


2021-10-24 09:51:24





Open in new tab


2021-11-09 07:00:43





Biological materials
MGNA-A931 (yefA::erm), available at the [ NBRP B. subtilis, Japan]
BKE06730 (Δ[gene|B97ABE3233A27A7C8273ED9A1E688247DD37FD12|rlmCD]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTATAATCACCTCTAGT,  downstream forward: _UP4_TTAAAAGAATAAATAGTCAA
BKK06730 (Δ[gene|B97ABE3233A27A7C8273ED9A1E688247DD37FD12|rlmCD]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTATAATCACCTCTAGT,  downstream forward: _UP4_TTAAAAGAATAAATAGTCAA


Page visits: 1073

Time of last update: 2021-11-29 12:45:33

Author of last update: Melvin.boenninger