SubtiWiki SubtiWiki
rlmCD
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rlmCD
168

rRNA methyltransferase

locus
BSU_06730
Molecular weight
51.65 kDa
pI
5.71
Protein length
Gene length
function
23S rRNA maturation
product
rRNA methyltransferase
essential
no
ec
2.1.1.190
synonyms
rlmCD, yerS, yefA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2265

This gene is a member of the following regulons

Gene
Coordinates
737,603 → 738,982
The protein
Catalyzed reaction/ biological activity
methylation of U747 and U1939 in 23S rRNA [Pubmed|21824914]
S-adenosyl-L-methionine + uridine747 in 23S rRNA --> 5-methyluridine747 in 23S rRNA + H+ + S-adenosyl-L-homocysteine (according to UniProt)
S-adenosyl-L-methionine + uridine1939 in 23S rRNA --> 5-methyluridine1939 in 23S rRNA + H+ + S-adenosyl-L-homocysteine (according to UniProt)
Protein family
[wiki|Methyltransferase superfamily] (according to UniProt)
[wiki|class I-like SAM-binding methyltransferase superfamily] (according to UniProt)
[wiki|Domains]
[wiki|TRAM domain] (aa 6-64) (according to UniProt)
[wiki|Cofactors]
Fe-S cluster [pubmed|29292548]
Structure
[PDB|2BH2] (from ''E. coli'', 32% identity) [Pubmed|15766524]
Paralogous protein(s)
[protein|05392BB2C32B0405799D4F34E5BA55FC936AB943|yfjO]
Expression and Regulation
Operons
genes
[gene|943294ACA74067A8549056699E08DF5B82337976|dgkB]-[gene|B97ABE3233A27A7C8273ED9A1E688247DD37FD12|rlmCD]
description
[Pubmed|22383849]
Open in new tab

[gene|943294ACA74067A8549056699E08DF5B82337976|dgkB]→[gene|B97ABE3233A27A7C8273ED9A1E688247DD37FD12|rlmCD]

2021-05-31 08:06:02

Jstuelk

4

c4890a496ded0653f7505864ebeaa248fc91af7f

322B8BEE164A821FAFE0FA8F102DB8F2A1E931B4

genes
[gene|943294ACA74067A8549056699E08DF5B82337976|dgkB]-[gene|B97ABE3233A27A7C8273ED9A1E688247DD37FD12|rlmCD]-[gene|5B5014A68D777DB79179904D5FD3D14DEE0BF1F4|yefC]-[gene|D3F00747006D974A8635D4391E0C261A3276E6AB|dnmA]-[gene|2E55D086DD5023B98929FB8B61238C00E66B8BCB|yeeB]-[gene|DB1AAC91947A6008F631266E5CC85B58703AFD9D|yeeC]
description
[Pubmed|22383849]
Open in new tab

[gene|943294ACA74067A8549056699E08DF5B82337976|dgkB]→[gene|DB1AAC91947A6008F631266E5CC85B58703AFD9D|yeeC]

2021-08-26 18:55:09

Jstuelk

6

ff916330f6b5023fdc317a5fb342282b6227f373

336CDC790AAC5927B58A940F2B9646F19FD7FCCD

Biological materials
Mutant
MGNA-A931 (yefA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/931 NBRP B. subtilis, Japan]
BKE06730 (Δ[gene|B97ABE3233A27A7C8273ED9A1E688247DD37FD12|rlmCD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06730 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTATAATCACCTCTAGT,  downstream forward: _UP4_TTAAAAGAATAAATAGTCAA
BKK06730 (Δ[gene|B97ABE3233A27A7C8273ED9A1E688247DD37FD12|rlmCD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06730 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTATAATCACCTCTAGT,  downstream forward: _UP4_TTAAAAGAATAAATAGTCAA
References
21824914,15766524

B97ABE3233A27A7C8273ED9A1E688247DD37FD12

Page visits: 1058

Time of last update: 2021-09-14 14:39:40

Author of last update: Melvin.boenninger