SubtiWiki SubtiWiki
yjmF
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yjmF
168

similar to D-mannonate oxidoreductase/ fructuronate reductase

locus
BSU_12350
Molecular weight
29.33 kDa
pI
5.25
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yjmF, uxuB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1028

This gene is a member of the following regulons

Gene
Coordinates
1,306,562 → 1,307,398
The protein
Protein family
[wiki|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
Structure
[PDB|4WUV] (the enzyme from ''Haemophilus influenzae'', 48% identity, 81% similarity)
Expression and Regulation
Operons
genes
[gene|3AEA5D769B89E676C916FD8934D762B4C9A02AA2|yjmC]-[gene|CC55984E31C5698668CCCD4AC6E2210B2B41ACAB|yjmD]-[gene|A0A6D36BEC397345A1D17E6A7C34E1F612FD46C7|uxuA]-[gene|B886E504A767343042DE9BF4E23E6798D124A2CF|yjmF]-[gene|6D08E897DD697523FD0720704A25AD4472075B6C|exuT]-[gene|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR]-[gene|A1C64447E0074B06C9210CC51680273FAAE703FA|uxaB]-[gene|ED29D2DE48AADEA09C90F08B6021555C357946B4|uxaA]
description
[Pubmed|9882655]
regulation
induced by galacturonate ([protein|search|ExuR]) [Pubmed|9882655]
regulatory mechanism
[protein|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR]: repression, in the absence of inducer, in [regulon|protein:69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [pubmed|9882655] [pubmed|10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9882655], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,9882655], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|3AEA5D769B89E676C916FD8934D762B4C9A02AA2|yjmC]→[gene|ED29D2DE48AADEA09C90F08B6021555C357946B4|uxaA]

2021-09-08 23:58:11

ghost

8

e9b60dda83535baf9252c89c7130d2fdeb844e6f

417675688A3DB0A933113CA632D3321516D969A2

genes
[gene|5A0C29C7E218701727523885D01A48D02266B421|uxaC]-[gene|59CD3E4C24326542D9C85BB6FE64FBF49869EB55|yjmB]-[gene|3AEA5D769B89E676C916FD8934D762B4C9A02AA2|yjmC]-[gene|CC55984E31C5698668CCCD4AC6E2210B2B41ACAB|yjmD]-[gene|A0A6D36BEC397345A1D17E6A7C34E1F612FD46C7|uxuA]-[gene|B886E504A767343042DE9BF4E23E6798D124A2CF|yjmF]-[gene|6D08E897DD697523FD0720704A25AD4472075B6C|exuT]-[gene|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR]-[gene|A1C64447E0074B06C9210CC51680273FAAE703FA|uxaB]-[gene|ED29D2DE48AADEA09C90F08B6021555C357946B4|uxaA]
description
[Pubmed|9882655]
regulation
induced by galacturonate ([protein|search|ExuR]) [Pubmed|9882655]
regulatory mechanism
[protein|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR]: repression, in the absence of inducer, in [regulon|protein:69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [pubmed|9882655] [pubmed|10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9882655], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|5A0C29C7E218701727523885D01A48D02266B421|uxaC]→[gene|ED29D2DE48AADEA09C90F08B6021555C357946B4|uxaA]

2021-09-16 06:28:29

ghost

8

0325999ea185bfaaf2dea87e1701479c52256033

A15F6E93B04DC8C4B59B7976DAC34CE9AC0B8E51

Biological materials
Mutant
MGNA-A370 (yjmF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/370 NBRP B. subtilis, Japan]
BKE12350 (Δ[gene|B886E504A767343042DE9BF4E23E6798D124A2CF|yjmF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGCCAGGTTCTCATGCAGCG,  downstream forward: _UP4_TAACGAAAGCGGTGCAACAG
BKK12350 (Δ[gene|B886E504A767343042DE9BF4E23E6798D124A2CF|yjmF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGCCAGGTTCTCATGCAGCG,  downstream forward: _UP4_TAACGAAAGCGGTGCAACAG
References
9579062,9882655,10666464

B886E504A767343042DE9BF4E23E6798D124A2CF

Page visits: 1089

Time of last update: 2021-09-16 02:08:02

Author of last update: Jstuelk