SubtiWiki SubtiWiki
alsT
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

alsT
168

putative glutamine transporter

locus
BSU_18120
Molecular weight
50.14 kDa
pI
9.39
Protein length
Gene length
function
uptake of glutamine
product
putative glutamine transporter
essential
no
synonyms
alsT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1115

This gene is a member of the following regulons

Gene
Coordinates
1,938,925 → 1,940,322
The protein
Protein family
[wiki|Alanine or glycine:cation symporter (AGCS) (TC 2.A.25) family] (according to UniProt)
Structure
[PDB|6CSE] (sodium/alanine symporter from Methanococcus maripaludis S2, 36% identity) [pubmed|30659158]
Paralogous protein(s)
[protein|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT], [protein|A10EA56A7EDA2DF712B5BB87D94A818E39940B44|yrbD], [protein|A69E7536DFE6353C4CD1B09D1258C88BF0FB8B4D|yflA]
[wiki|Localization]
cell membrane (according to Swiss-Prot),  membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|B84BE9F5BEFE3A295ED5580D66040CD28609A6A1|alsT]
description
[pubmed|22383849]
regulation
repressed in the absence of good nitrogen sources (glutamine or ammonium) ([gene|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]) [Pubmed|12823818]
repressed in the presence of glutamine ([protein|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]) [Pubmed|28835263]
regulatory mechanism
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: repression, [Pubmed|12823818], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]: repression, [pubmed|28835263], in [regulon|protein:641C4BDD9702804642E1753A9C779E80FABB3919|glnR regulon]
Open in new tab

[gene|B84BE9F5BEFE3A295ED5580D66040CD28609A6A1|alsT]

2020-11-06 12:56:32

Jstuelk

0

7a0c0dadf78c53fdf5241cd6ba6448013c53ae2f

4ABCFB97E4BF5587EDCA2F8D8DB489A57AAD7344

Biological materials
Mutant
GP1888 (Δ[gene|B84BE9F5BEFE3A295ED5580D66040CD28609A6A1|alsT]::tet), available in [wiki|Jörg Stülke]'s lab [pubmed|32743959]
BKE18120 (Δ[gene|B84BE9F5BEFE3A295ED5580D66040CD28609A6A1|alsT]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18120 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTACCTCCCGTTTTC,  downstream forward: _UP4_TAATATAAATATAAAACAAA
BKK18120 (Δ[gene|B84BE9F5BEFE3A295ED5580D66040CD28609A6A1|alsT]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18120 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTACCTCCCGTTTTC,  downstream forward: _UP4_TAATATAAATATAAAACAAA
References
12823818,25755103,18763711,29326168,28835263,31997474,30659158

B84BE9F5BEFE3A295ED5580D66040CD28609A6A1

Page visits: 1972

Time of last update: 2021-09-16 18:57:54

Author of last update: Jstuelk