SubtiWiki SubtiWiki
yxjF

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yxjF
168

sporulation protein, 3-hydroxybutyrate dehydrogenase

locus
BSU_38970
Molecular weight
27.46 kDa
pI
7.89
Protein length
Gene length
function
3-hydroxybutyrate utilization
product
3-hydroxybutyrate dehydrogenase
essential
no
synonyms
yxjF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1028

This gene is a member of the following regulons

Gene
Coordinates
4,000,539 → 4,001,312
The protein
Protein family
[wiki|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
Structure
[PDB|2YZ7] (from Alcaligenes Faecalis 42% identity)
Paralogous protein(s)
[protein|D945CAD7209CB94A7B9E23263476124B7E8853DD|yusZ]
[protein|0DD474462720CAEE2AE17017BD7CA385238EBC6F|yxbG], (35%)
Expression and Regulation
Operons
genes
[gene|B416BB368A96926526458B2258BF8AB928D7C15E|hbuT]-[gene|A7E61C3D12BBDDD3EFD65B1EDBE280497D7B6CD0|scoA]-[gene|7F46EDA8F1EB8D9817C62D7D361FF32F9CD814AD|scoB]-[gene|B7B1D28E50244704324920E5A6F110DA8D63F6C0|yxjF]
description
[Pubmed|10746760]
regulation
expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|12662922]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135,10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|12662922], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|B416BB368A96926526458B2258BF8AB928D7C15E|hbuT]→[gene|B7B1D28E50244704324920E5A6F110DA8D63F6C0|yxjF]

2021-10-02 12:19:46

ghost

9

49dda0fadfba300315a7543307ab331d78e27e4b

9C2F2DF9D8BDF9896BE318E36ACFA3F55755DB86

Biological materials
Mutant
MGNA-B730 (yxjF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1729 NBRP B. subtilis, Japan]
GP1112 (spc), available in [wiki|Stülke] lab
BKE38970 (Δ[gene|B7B1D28E50244704324920E5A6F110DA8D63F6C0|yxjF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCAAACACCTTCCCAT,  downstream forward: _UP4_TGACATAAAAAACACACTTG
BKK38970 (Δ[gene|B7B1D28E50244704324920E5A6F110DA8D63F6C0|yxjF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCAAACACCTTCCCAT,  downstream forward: _UP4_TGACATAAAAAACACACTTG
References
16672620,10666464,12850135,10746760,12662922

B7B1D28E50244704324920E5A6F110DA8D63F6C0

Page visits: 1113

Time of last update: 2021-10-19 13:16:51

Author of last update: Jstuelk