SubtiWiki SubtiWiki
ytdI

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ytdI
168

inorganic polyphosphate/ATP-NAD kinase

locus
BSU_29540
Molecular weight
30.10 kDa
pI
6.49
Protein length
Gene length
function
generation of NADP from NAD
product
inorganic polyphosphate/ATP-NAD kinase
essential
no
ec
2.7.1.23
synonyms
ytdI, ppnKB, nadK2

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0061

This gene is a member of the following regulons

Gene
Coordinates
3,021,233 → 3,022,036
The protein
Catalyzed reaction/ biological activity
ATP + NAD+ --> ADP + H+ + NADP+ (according to UniProt)
Protein family
NAD kinase family (with [protein|2A2640A0501ECEA44A3C0C4842FAC053FB422A1F|nadF], according to UniProt)
Structure
[PDB|1YT5] (from ''Thermotoga maritima'') [Pubmed|16511117]
Paralogous protein(s)
[protein|2A2640A0501ECEA44A3C0C4842FAC053FB422A1F|nadF]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|B729EFC0BF0D75765C2D2B0B4F397E0AEE11F1E7|ytdI]
description
[Pubmed|21815947]
additional information
half-life of the mRNA: 8.4 min, in a [gene|6AC80B5916EEA851E9A7AF586341C58B7E69D8E7|roxS] mutant 15 min, in a [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny] mutant 24 min [PubMed|25643072]
Open in new tab

[gene|B729EFC0BF0D75765C2D2B0B4F397E0AEE11F1E7|ytdI]

2021-11-24 23:28:09

Jstuelk

9

9193b34021a7e2ce17bd07e6b596c89b1cfc3206

327B8F626F79E38490CC9BF40C48DAE90D4AC1D3

Other regulations
[protein|6AC80B5916EEA851E9A7AF586341C58B7E69D8E7|roxS]: translation inhibition, inhibition of translation and initiation of RNA degradation by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny] and [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|rnc] [Pubmed|25643072] translation is inhibited by binding of the [protein|6AC80B5916EEA851E9A7AF586341C58B7E69D8E7|roxS] RNA to the mRNA [Pubmed|25643072]
Biological materials
Mutant
MGNA-A109 (ytdI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/109 NBRP B. subtilis, Japan]
BKE29540 (Δ[gene|B729EFC0BF0D75765C2D2B0B4F397E0AEE11F1E7|ytdI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCCCATTTCCCCTTTG,  downstream forward: _UP4_TAGAAAATAAAAGGACAGGC
BKK29540 (Δ[gene|B729EFC0BF0D75765C2D2B0B4F397E0AEE11F1E7|ytdI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCCCATTTCCCCTTTG,  downstream forward: _UP4_TAGAAAATAAAAGGACAGGC
References
16511117,25643072,21815947

B729EFC0BF0D75765C2D2B0B4F397E0AEE11F1E7

Page visits: 1663

Time of last update: 2021-12-01 22:09:10

Author of last update: Robert.warneke