SubtiWiki SubtiWiki
ytdI
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ytdI
168

inorganic polyphosphate/ATP-NAD kinase

locus
BSU_29540
Molecular weight
30.10 kDa
pI
6.49
Protein length
Gene length
function
generation of NADP from NAD
product
inorganic polyphosphate/ATP-NAD kinase
essential
no
ec
2.7.1.23
synonyms
ytdI, ppnKB, nadK2

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0061

This gene is a member of the following regulons

Gene
Coordinates
3,021,233 → 3,022,036
The protein
Catalyzed reaction/ biological activity
ATP + NAD+ --> ADP + H+ + NADP+ (according to UniProt)
Protein family
NAD kinase family (with [protein|2A2640A0501ECEA44A3C0C4842FAC053FB422A1F|nadF], according to UniProt)
Structure
[PDB|1YT5] (from ''Thermotoga maritima'') [Pubmed|16511117]
Paralogous protein(s)
[protein|2A2640A0501ECEA44A3C0C4842FAC053FB422A1F|nadF]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|B729EFC0BF0D75765C2D2B0B4F397E0AEE11F1E7|ytdI]
description
[Pubmed|21815947]
additional information
half-life of the mRNA: 8.4 min, in a [gene|6AC80B5916EEA851E9A7AF586341C58B7E69D8E7|roxS] mutant 15 min, in a [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny] mutant 24 min [PubMed|25643072]
Open in new tab

[gene|B729EFC0BF0D75765C2D2B0B4F397E0AEE11F1E7|ytdI]

2021-06-23 08:22:43

Jstuelk

3

9193b34021a7e2ce17bd07e6b596c89b1cfc3206

327B8F626F79E38490CC9BF40C48DAE90D4AC1D3

Other regulations
[protein|6AC80B5916EEA851E9A7AF586341C58B7E69D8E7|roxS]: translation inhibition, inhibition of translation and initiation of RNA degradation by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny] and [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|rnc] [Pubmed|25643072] translation is inhibited by binding of the [protein|6AC80B5916EEA851E9A7AF586341C58B7E69D8E7|roxS] RNA to the mRNA [Pubmed|25643072]
Biological materials
Mutant
MGNA-A109 (ytdI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/109 NBRP B. subtilis, Japan]
BKE29540 (Δ[gene|B729EFC0BF0D75765C2D2B0B4F397E0AEE11F1E7|ytdI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCCCATTTCCCCTTTG,  downstream forward: _UP4_TAGAAAATAAAAGGACAGGC
BKK29540 (Δ[gene|B729EFC0BF0D75765C2D2B0B4F397E0AEE11F1E7|ytdI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCCCATTTCCCCTTTG,  downstream forward: _UP4_TAGAAAATAAAAGGACAGGC
References
16511117,25643072,21815947

B729EFC0BF0D75765C2D2B0B4F397E0AEE11F1E7

Page visits: 1619

Time of last update: 2021-09-16 16:30:11

Author of last update: Robert.warneke