SubtiWiki SubtiWiki
yhfH
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yhfH
168

unknown

locus
BSU_10230
Molecular weight
5.16 kDa
pI
6.73
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yhfH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,098,120 → 1,098,260
Expression and Regulation
Operons
genes
[gene|B71A9B38FAAD7F96BB1D733ACB978B12B1EB9EF3|yhfH]
description
[Pubmed|21815947]
regulatory mechanism
[protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR]: unknown, [pubmed|30355672], in [regulon|protein:F4097349A563503468A2A14F062AEAC532C7917A|ylxR regulon]
additional information
the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR] [pubmed|30355672]
Open in new tab

[gene|B71A9B38FAAD7F96BB1D733ACB978B12B1EB9EF3|yhfH]

2021-06-26 05:28:57

Jstuelk

3

42bb6285eff90703487c678eaa69bcd049c4fd0d

26D0E2C07D006F5A78DC7D16C098AA106028ACA0

Biological materials
Mutant
BKE10230 (Δ[gene|B71A9B38FAAD7F96BB1D733ACB978B12B1EB9EF3|yhfH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATCCCTCTTTCCCCTTTG,  downstream forward: _UP4_TAATGAGCGAAAATCCCGCG
BKK10230 (Δ[gene|B71A9B38FAAD7F96BB1D733ACB978B12B1EB9EF3|yhfH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATCCCTCTTTCCCCTTTG,  downstream forward: _UP4_TAATGAGCGAAAATCCCGCG
References
21815947,30355672

B71A9B38FAAD7F96BB1D733ACB978B12B1EB9EF3

Page visits: 1752

Time of last update: 2021-09-15 17:43:20

Author of last update: Jstuelk