SubtiWiki SubtiWiki
ycdF
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycdF
168

general stress protein, similar to glucose 1-dehydrogenase, survival of ethanol stress and low temperatures

locus
BSU_02830
Molecular weight
27.62 kDa
pI
5.74
Protein length
Gene length
function
survival of ethanol stress and low temperatures
product
unknown
essential
no
ec
1.1.1.47
synonyms
ycdF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1028

This gene is a member of the following regulons

Gene
Coordinates
305,658 → 306,434
The protein
Catalyzed reaction/ biological activity
Beta-D-glucose + NAD(P)+ --> D-glucono-1,5-lactone + NAD(P)H (according to UniProt)
Beta-D-glucose + NAD+ --> D-glucono-1,5-lactone + NADH (according to UniProt)
Protein family
[wiki|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
Structure
[PDB|1GEE] (from ''Bacillus megaterium'', 56% identity)
Paralogous protein(s)
[protein|0DD474462720CAEE2AE17017BD7CA385238EBC6F|yxbG], [protein|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|bacC], [protein|248F0805272FED9B38ECBB31E2872BC9EC163CE0|ymfI], [protein|439B468A13137000FB42E9389391CB4986FFED84|fabG], [protein|6BA346D8A7B496F9618AFAB4FEEF4BD1A41D2C7E|yoxD]
[protein|CA4597C6253CCF7D7954686A30AF041808BDF8E5|gdh], (53%)
[protein|CE990D33A12C50D22506A52E0099F7D97A762D4E|fadH], (31.9%)
[protein|EAEEA4DD9641919830A81185333A2610B964D37C|yhdF], (34.3%)
[protein|FBBDE1E058223D5E8CEB07CAA50940A329C809E4|kduD], (34.3%)
[protein|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD], (69%)
[protein|4DEFC2998464BF8327578C36A13A10DD277F991E|ykvO], (31,9%)
[protein|6047F2493FCE3D2A9BDB1AD88E5926ECEED81036|yhxC], (32,4%),
[protein|739B228743BC1FE9E6888E999BC0E4F615E36F9E|yhxD], (31,1%)
[protein|5964B6E817260DA7937796DDFA753A665A04D650|fabL], (31.6%)
Expression and Regulation
Operons
genes
[gene|B6FF689E65906186F3576B378650D713DB84EDDA|ycdF]-[gene|A641BA91317CBCFE34A2BE69007247F209075095|ycdG]
description
[Pubmed|15805528]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528,11544224]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528,11544224], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|B6FF689E65906186F3576B378650D713DB84EDDA|ycdF]→[gene|A641BA91317CBCFE34A2BE69007247F209075095|ycdG]

2021-09-02 03:21:32

ghost

3

22eb8e4a5f3738fe6914742f46af74f81b9c90a9

CC9BB92A08F6FA00BFDF6CC244282F733CBD5AB7

Biological materials
Mutant
MGNA-C046 (ycdF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2044 NBRP B. subtilis, Japan]
BKE02830 (Δ[gene|B6FF689E65906186F3576B378650D713DB84EDDA|ycdF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACTTGATATCCTCCTCT,  downstream forward: _UP4_TAGAAGACAAAACAGGGGGA
BKK02830 (Δ[gene|B6FF689E65906186F3576B378650D713DB84EDDA|ycdF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACTTGATATCCTCCTCT,  downstream forward: _UP4_TAGAAGACAAAACAGGGGGA
References
10220166,15805528

B6FF689E65906186F3576B378650D713DB84EDDA

Page visits: 1509

Time of last update: 2021-08-11 01:28:18

Author of last update: Melvin.boenninger