SubtiWiki SubtiWiki
yvfR
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvfR
168

similar to [wiki|ABC transporter] (ATP-binding protein)

locus
BSU_34090
Molecular weight
33.63 kDa
pI
6.17
Protein length
Gene length
function
unknown
product
[wiki|ABC transporter] (ATP-binding protein)
essential
no
synonyms
yvfR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1131

This gene is a member of the following regulons

Gene
Coordinates
3,498,352 → 3,499,257
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transporter domain] (aa 6-230) (according to UniProt)
Structure
[PDB|4YER] (from Thermotoga maritima, 32% identity)
[wiki|Localization]
plasma membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|B6BBB827CB475423FC9A781058141B7D05C4D284|yvfR]-[gene|72E387D5D44FA20D6EEFF1B39B6C9F322F966FC5|yvfS]
description
[Pubmed|26647299]
Open in new tab

[gene|B6BBB827CB475423FC9A781058141B7D05C4D284|yvfR]→[gene|72E387D5D44FA20D6EEFF1B39B6C9F322F966FC5|yvfS]

2021-08-22 22:38:33

Jstuelk

6

5f1eb1eb321cb9706c12db9b884cc9b8516a94ac

75A5C2472020222643FA6A9D3311039F68CE4122

Biological materials
Mutant
MGNA-A481 (yvfR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/481 NBRP B. subtilis, Japan]
BKE34090 (Δ[gene|B6BBB827CB475423FC9A781058141B7D05C4D284|yvfR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACATGAGCACCTCCTGATC,  downstream forward: _UP4_GACGGCAACAGGGAGGCGAT
BKK34090 (Δ[gene|B6BBB827CB475423FC9A781058141B7D05C4D284|yvfR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACATGAGCACCTCCTGATC,  downstream forward: _UP4_GACGGCAACAGGGAGGCGAT
References
10092453,26647299,28461449

B6BBB827CB475423FC9A781058141B7D05C4D284

Page visits: 1069

Time of last update: 2021-09-06 14:02:23

Author of last update: Melvin.boenninger