SubtiWiki SubtiWiki
yvzF

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yvzF
168

unknown

locus
BSU_33049
Molecular weight
7.30 kDa
pI
9.397
Protein length
Gene length
function
unknown
product
unknown
essential
-
ec
null
synonyms
yvzF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,390,479 → 3,390,664
Expression and Regulation
Operons
genes
[gene|B66AE23754A9CD4D5BCFC75CE6918522C7A22DA6|yvzF]-[gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]
description
[Pubmed|22383849]
Open in new tab

[gene|B66AE23754A9CD4D5BCFC75CE6918522C7A22DA6|yvzF]→[gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]

2021-10-12 20:41:07

Jstuelk

6

c28acc96673d71951fe74a0d40b62855c8b1ac77

B19CAD8573AA314740B2D7087906641C90CBC9B6

Biological materials
Mutant
BKE33049 (Δ[gene|B66AE23754A9CD4D5BCFC75CE6918522C7A22DA6|yvzF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33049 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTCGTATCCTCCGCTTT,  downstream forward: _UP4_TAAAAAGGATTTTTTGTGTC
BKK33049 (Δ[gene|B66AE23754A9CD4D5BCFC75CE6918522C7A22DA6|yvzF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33049 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTCGTATCCTCCGCTTT,  downstream forward: _UP4_TAAAAAGGATTTTTTGTGTC

B66AE23754A9CD4D5BCFC75CE6918522C7A22DA6

Page visits: 553

Time of last update: 2021-10-05 05:33:08

Author of last update: Bzhu