SubtiWiki SubtiWiki
ptsG

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ptsG
168

glucose permease of the [wiki|phosphotransferase systems|phosphotransferase system], EIICBA of the [category|SW.1.2.2|PTS], [category|SW.3.4.3|Trigger enzyme], control of [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT] activity

locus
BSU_13890
Molecular weight
75.34 kDa
pI
5.41
Protein length
Gene length
function
glucose transport and phosphorylation, control of [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT] activity
product
glucose permease, trigger enzyme
essential
no
ec
2.7.1.69
synonyms
ptsG, ptsX, crr

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2190

This gene is a member of the following regulons

Gene
Coordinates
1,457,187 → 1,459,286
The protein
Catalyzed reaction/ biological activity
transport and phosphorylation of glucose, receives a phosphate from [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]] at the IIA domain (His-620), the phosphate group is then transferred to the IIB domain (Cys-461) an finally to the incoming glucose. In the absence of glucose, PtsG phosphorylates and thereby inactivates the transcriptional antiterminator [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT].
D-glucose + Nπ-phospho-L-histidyl-[protein] --> D-glucose 6-phosphate + L-histidyl-[protein] (according to UniProt)
Protein family
[category|SW.1.2.2|PTS] permease, glucose family [Pubmed|10627040]
[wiki|Domains]
11x transmembrane domain (16–36, 89–109, 139–159, 180–200, 233–253, 283–303, 313–333, 338–358, 365–385, 388–408)
[wiki|PTS EIIA domain] type-1 (aa 568–672) (according to UniProt)
[wiki|PTS EIIB domain] type-1 (aa 439–520) (according to UniProt)
[wiki|PTS EIIC domain] type-1 (aa 1-424) (according to UniProt)
Structure
[PDB|5IWS] (the IIC domain of B. cereus MalT, 32% identity) [pubmed|27161976]
[PDB|1AX3] (IIA domain) [pubmed|9593197]
[PDB|1GPR] (IIA domain)
Modification
transient  phosphorylation ([protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]]-dependent) on His-620, then internal phosphotransfer from His-620 to Cys-461
[wiki|Localization]
membrane protein [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]
description
[Pubmed|11902727]
regulation
expression activated by glucose (2 fold) ([protein|search|GlcT]) [Pubmed|12850135]
regulatory mechanism
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
[protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]: antitermination, via the [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]-dependent [wiki|RNA switch] [PubMed|9765562], in [regulon|protein:BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11902727], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]→[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]

2021-11-19 20:19:24

ghost

23

0d1ff574eb4a847a56452c8c7084e1e199118b30

EEB2B4E2EFD5EB6876956633E22D1305FFE807F7

Biological materials
Mutant
GP778 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]-[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::spc) [Pubmed|22722928], available in [wiki|Jörg Stülke]'s lab
BKE13890 (Δ[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13890 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT,  downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
BKK13890 (Δ[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13890 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT,  downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
Expression vectors
pGP123 (domains BA, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP141 (domains BA, mut: H620D, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP428 (EIIB, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP437(EIIA in [wiki|pGP570], with thrombin cleavage site), available in [wiki|Jörg Stülke]'s lab
lacZ fusion
pGP34 ([wiki|pAC5]) [Pubmed|11902727], available in [wiki|Jörg Stülke]'s lab
pGP66 ([wiki|pAC7]) [Pubmed|11902727], available in [wiki|Jörg Stülke]'s lab
pGP606 (mutant terminator, [wiki|pAC6]), available in [wiki|Jörg Stülke]'s lab
pGP532 ([wiki|pAC7]), available in [wiki| Jörg Stülke]'s lab
series of promoter deletions are available in [wiki|pAC5] and [wiki|pAC6], available in [wiki|Jörg Stülke]'s lab
series of RAT mutants are available in [wiki|pAC6], available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
References
Reviews
18086213
Original Publications
10627040,12850135,18763711,11902727,9765562,9513271,1956301,10543968,17074746,15155854,14527945,1508157,2120236,9593197,8418852,1581296,1316146,1733770,1942043,1911744,1906345,20081037,22846916,1447219,27161976,9593197,30038046,31740237

B5E7EB475434E96786C577AE709A21BD702733D8

Page visits: 4584

Time of last update: 2021-11-25 04:46:38

Author of last update: Jstuelk