SubtiWiki SubtiWiki
ptsG
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ptsG
168

glucose permease of the [wiki|phosphotransferase systems|phosphotransferase system], EIICBA of the [category|SW.1.2.2|PTS], [category|SW.3.4.3|Trigger enzyme], control of [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT] activity

locus
BSU_13890
Molecular weight
75.34 kDa
pI
5.41
Protein length
Gene length
function
glucose transport and phosphorylation, control of [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT] activity
product
glucose permease, trigger enzyme
essential
no
ec
2.7.1.69
synonyms
ptsG, ptsX, crr

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2190

This gene is a member of the following regulons

Gene
Coordinates
1,457,187 → 1,459,286
The protein
Catalyzed reaction/ biological activity
transport and phosphorylation of glucose, receives a phosphate from [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]] at the IIA domain (His-620), the phosphate group is then transferred to the IIB domain (Cys-461) an finally to the incoming glucose. In the absence of glucose, PtsG phosphorylates and thereby inactivates the transcriptional antiterminator [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT].
D-glucose + Nπ-phospho-L-histidyl-[protein] --> D-glucose 6-phosphate + L-histidyl-[protein] (according to UniProt)
Protein family
[category|SW.1.2.2|PTS] permease, glucose family [Pubmed|10627040]
[wiki|Domains]
11x transmembrane domain (16–36, 89–109, 139–159, 180–200, 233–253, 283–303, 313–333, 338–358, 365–385, 388–408)
[wiki|PTS EIIA domain] type-1 (aa 568–672) (according to UniProt)
[wiki|PTS EIIB domain] type-1 (aa 439–520) (according to UniProt)
[wiki|PTS EIIC domain] type-1 (aa 1-424) (according to UniProt)
Structure
[PDB|5IWS] (the IIC domain of B. cereus MalT, 32% identity) [pubmed|27161976]
[PDB|1AX3] (IIA domain) [pubmed|9593197]
[PDB|1GPR] (IIA domain)
Modification
transient  phosphorylation ([protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]]-dependent) on His-620, then internal phosphotransfer from His-620 to Cys-461
[wiki|Localization]
membrane protein [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]
description
[Pubmed|11902727]
regulation
expression activated by glucose (2 fold) ([protein|search|GlcT]) [Pubmed|12850135]
regulatory mechanism
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
[protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]: antitermination, via the [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]-dependent [wiki|RNA switch] [PubMed|9765562], in [regulon|protein:BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11902727], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]→[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]

2021-08-15 20:34:07

ghost

12

0d1ff574eb4a847a56452c8c7084e1e199118b30

EEB2B4E2EFD5EB6876956633E22D1305FFE807F7

Biological materials
Mutant
GP778 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]-[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::spc) [Pubmed|22722928], available in [wiki|Jörg Stülke]'s lab
BKE13890 (Δ[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13890 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT,  downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
BKK13890 (Δ[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13890 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT,  downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
Expression vectors
pGP123 (domains BA, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP141 (domains BA, mut: H620D, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP428 (EIIB, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP437(EIIA in [wiki|pGP570], with thrombin cleavage site), available in [wiki|Jörg Stülke]'s lab
lacZ fusion
pGP34 ([wiki|pAC5]) [Pubmed|11902727], available in [wiki|Jörg Stülke]'s lab
pGP66 ([wiki|pAC7]) [Pubmed|11902727], available in [wiki|Jörg Stülke]'s lab
pGP606 (mutant terminator, [wiki|pAC6]), available in [wiki|Jörg Stülke]'s lab
pGP532 ([wiki|pAC7]), available in [wiki| Jörg Stülke]'s lab
series of promoter deletions are available in [wiki|pAC5] and [wiki|pAC6], available in [wiki|Jörg Stülke]'s lab
series of RAT mutants are available in [wiki|pAC6], available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
References
Reviews
18086213
Original Publications
10627040,12850135,18763711,11902727,9765562,9513271,1956301,10543968,17074746,15155854,14527945,1508157,2120236,9593197,8418852,1581296,1316146,1733770,1942043,1911744,1906345,20081037,22846916,1447219,27161976,9593197,30038046,31740237

B5E7EB475434E96786C577AE709A21BD702733D8

Page visits: 4531

Time of last update: 2021-09-16 18:11:45

Author of last update: Jstuelk