SubtiWiki SubtiWiki
fadE
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

fadE
168

acyl-CoA dehydrogenase

locus
BSU_32820
Molecular weight
65.16 kDa
pI
5.15
Protein length
Gene length
function
fatty acid degradation
product
acyl-CoA dehydrogenase
essential
no
synonyms
fadE, yusJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1960

This gene is a member of the following regulons

Gene
Coordinates
3,367,040 → 3,368,824
The protein
Catalyzed reaction/ biological activity
A + 2,3-saturated acyl-CoA --> 2,3-dehydroacyl-CoA + AH2 (according to UniProt)
Protein family
[wiki|Acyl-CoA dehydrogenase family] (according to UniProt)
[wiki|Cofactors]
FAD (according to UniProt)
Structure
[PDB|2Z1Q] (from ''Thermus thermophilus hb8'', 52% identity, 68% similarity)
Paralogous protein(s)
[protein|BA28DFBAF88A4994B0541D1FF2187312FDE1FA15|yngJ], [protein|7D89BBB52403BF99416250688EFA90C2BE8EB591|acdA]
[protein|F25CDDEBAFC72036664323619F5197D45E86BE9A|mmgC], Array
[wiki|Localization]
cell membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|4787161A022E938A6D58A505D92369F889C7DE04|fadN]-[gene|07498A0A3CB598A6E388540124A4F56E781C86FA|fadA]-[gene|B5325CBF1408E2CA227EB462092E209F4C87E797|fadE]
description
[Pubmed|17189250]
regulation
''[protein|search|fadN]'': induced by long-chain fatty acids ([protein|search|FadR]) [Pubmed|17189250]
regulatory mechanism
[protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]: activation, [Pubmed|12817086], in [regulon|protein:29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR regulon]
[protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]: repression, [Pubmed|17189250], in [regulon|protein:8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|21398533], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|17189250], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|4787161A022E938A6D58A505D92369F889C7DE04|fadN]→[gene|B5325CBF1408E2CA227EB462092E209F4C87E797|fadE]

2021-09-06 05:32:15

ghost

9

5f1e349b432a9058e9ca7ab2008a19fa9609b3d3

64A593E7BDE4F4B739AFAF65983E90DDA2D2CE72

genes
[gene|F8C51A86268DC6B2152B139D2D0B25CC3D69A5D5|fadM]-[gene|4787161A022E938A6D58A505D92369F889C7DE04|fadN]-[gene|07498A0A3CB598A6E388540124A4F56E781C86FA|fadA]-[gene|B5325CBF1408E2CA227EB462092E209F4C87E797|fadE]
description
[Pubmed|17189250]
regulation
''[protein|search|fadM]'': induced by long-chain fatty acids ([protein|search|FadR]) [Pubmed|17189250]
regulatory mechanism
[protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]: repression, [Pubmed|17189250], in [regulon|protein:8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR regulon]
[protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]: activation, [Pubmed|12817086], in [regulon|protein:29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR regulon]
Open in new tab

[gene|F8C51A86268DC6B2152B139D2D0B25CC3D69A5D5|fadM]→[gene|B5325CBF1408E2CA227EB462092E209F4C87E797|fadE]

2021-05-23 19:05:30

ghost

5

9bfdfb93c4077983c0e3142e433ac74ae81a5d62

8E61A92B7F4E3CA1E4373E8AFCCD07598481ACA4

Biological materials
Mutant
MGNA-A602 (yusJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/602 NBRP B. subtilis, Japan]
BKE32820 (''[gene|B5325CBF1408E2CA227EB462092E209F4C87E797|fadE]''::''erm'', available in the BGSC, in [wiki|Fabian Commichau]'s, and in [wiki|Jörg Stülke]'s lab) [pubmed|28189581]
BKE32820 (Δ[gene|B5325CBF1408E2CA227EB462092E209F4C87E797|fadE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32820 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTTTTCCCCCTTTA,  downstream forward: _UP4_TGATTGGCCATGAGCTCCGC
BKK32820 (Δ[gene|B5325CBF1408E2CA227EB462092E209F4C87E797|fadE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32820 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTTTTCCCCCTTTA,  downstream forward: _UP4_TGATTGGCCATGAGCTCCGC
References
17189250,12817086,18763711,23033921,21398533

B5325CBF1408E2CA227EB462092E209F4C87E797

Page visits: 1459

Time of last update: 2021-09-15 10:22:49

Author of last update: Melvin.boenninger