SubtiWiki SubtiWiki
yurS

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yurS
168

sporulation protein

locus
BSU_32650
Molecular weight
10.29 kDa
pI
4.61
Protein length
Gene length
function
unknown
product
sporulation protein
essential
no
ec
null
synonyms
yurS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,354,212 → 3,354,487
Expression and Regulation
Operons
genes
[gene|0B97EA2CAE873DB4BC541FB87FC784C88B4DC5C3|sspG]-[gene|B46AB216DE0828E4CD5714CADE5C25C1B5AF75DC|yurS]
description
[Pubmed|9852018]
regulation
expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|15699190,9852018]
regulatory mechanism
[protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]: activation, [Pubmed|9852018], in [regulon|protein:19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE regulon]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|15699190,9852018], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab

[gene|0B97EA2CAE873DB4BC541FB87FC784C88B4DC5C3|sspG]→[gene|B46AB216DE0828E4CD5714CADE5C25C1B5AF75DC|yurS]

2021-10-05 16:27:50

ghost

2

0212569ab285de6f6fa6f328401107f1e018fc91

ADE853E2E644B92ADA3577E373D9E91BA5F9D399

Biological materials
Mutant
BKE32650 (Δ[gene|B46AB216DE0828E4CD5714CADE5C25C1B5AF75DC|yurS]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAGTCTTCTCCGTCTTG,  downstream forward: _UP4_TAAAAAACCGCGGCCCCTCG
BKK32650 (Δ[gene|B46AB216DE0828E4CD5714CADE5C25C1B5AF75DC|yurS]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAGTCTTCTCCGTCTTG,  downstream forward: _UP4_TAAAAAACCGCGGCCCCTCG
References
9852018,15699190,12850135

B46AB216DE0828E4CD5714CADE5C25C1B5AF75DC

Page visits: 854

Time of last update: 2021-10-01 19:41:08

Author of last update: Bzhu