SubtiWiki SubtiWiki
ylaD

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ylaD
168

redox sensor, control of sigma factor [protein|544344B61A804F367BB726976E0C87B61998490A|ylaC]

locus
BSU_14740
Molecular weight
11.27 kDa
pI
4.47
Protein length
Gene length
function
control of sigma factor [protein|544344B61A804F367BB726976E0C87B61998490A|ylaC]
product
anti-Sigma ([protein|544344B61A804F367BB726976E0C87B61998490A|ylaC])
essential
no
synonyms
ylaD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5660

This gene is a member of the following regulons

Gene
Coordinates
1,544,603 → 1,544,896
The protein
Protein family
zinc-associated anti-sigma factor (ZAS) superfamily (with [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW], according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|6BB9336E8F5007274026A89BFC3744B52F28E42D|ylaA]-[gene|0703D458DB489F49150DD9E3477A87DC354A7B7F|ylaB]-[gene|544344B61A804F367BB726976E0C87B61998490A|ylaC]-[gene|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD]
description
[Pubmed|16501307]
regulation
[protein|search|Spx]: transcription activation [Pubmed|16501307]
regulatory mechanism
[protein|2C6386E9A63F410558D168798D077DF91590F454|spx]: activation, [Pubmed|16501307], in [regulon|protein:2C6386E9A63F410558D168798D077DF91590F454|spx regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|16501307], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|544344B61A804F367BB726976E0C87B61998490A|ylaC]: sigma factor, [Pubmed|16501307], in [regulon|protein:544344B61A804F367BB726976E0C87B61998490A|ylaC regulon]
Open in new tab

[gene|6BB9336E8F5007274026A89BFC3744B52F28E42D|ylaA]→[gene|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD]

2021-10-17 17:33:39

ghost

8

7f8af0ac683cfbdb26958147ed94824b4e8127cb

4C1E65F06DFC6C766EDB2CC96642EC3BE04147A6

genes
[gene|544344B61A804F367BB726976E0C87B61998490A|ylaC]-[gene|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD]
description
[Pubmed|16501307]
regulation
[protein|search|Spx]: transcription activation [Pubmed|16501307]
Open in new tab

[gene|544344B61A804F367BB726976E0C87B61998490A|ylaC]→[gene|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD]

2021-10-20 17:42:17

ghost

7

c3bcd5ca9623666f9deb8cdfd05c2b936d3120c8

CE8DA7703E5FB7681C88A3CF07CB46454E7465C9

Biological materials
Mutant
MGNA-A535 (ylaD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/535 NBRP B. subtilis, Japan]
BKE14740 (Δ[gene|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GGTCATATCCGCTCCTCCTC,  downstream forward: _UP4_TAAAAAAAGCGCTTGTCCGA
BKK14740 (Δ[gene|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GGTCATATCCGCTCCTCCTC,  downstream forward: _UP4_TAAAAAAAGCGCTTGTCCGA
References
16501307,16728958,29760236

B454D14B33E2C11F0BB0A1D1BB743FA64981A966

Page visits: 1169

Time of last update: 2021-10-17 14:30:44

Author of last update: Melvin.boenninger