yojB

yojB
168

unknown

locus
BSU_19510
Molecular weight
7.99 kDa
pI
9.38
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yojB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5893 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,124,529 → 2,124,765
The protein
Structure
[AF|O31861]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|C62164C159495FDE001F36AF5F6E35C10812ABE4|yojA]-[gene|B412E210FE99EB973818CDD86E56E6F367D7BEFC|yojB]
description
[Pubmed|22383849]
Open in new tab

[gene|C62164C159495FDE001F36AF5F6E35C10812ABE4|yojA]→[gene|B412E210FE99EB973818CDD86E56E6F367D7BEFC|yojB]

2024-02-10 23:28:28

Jstuelk

38

6a13e19c863fd859069ee42bd731ce3be3c900a6

7067EAFBE7A828BCB9B9DB0F589FA5791BCE39D2

genes
[gene|B412E210FE99EB973818CDD86E56E6F367D7BEFC|yojB]
description
[Pubmed|22383849]
Open in new tab

[gene|B412E210FE99EB973818CDD86E56E6F367D7BEFC|yojB]

2024-02-15 03:53:01

Jstuelk

35

38116ad21bd7bb6237e4067fc4ce2a6c467a582a

909AAC1E4DFEED54EBDFA64FF261B86E08F98A0E

Biological materials
Mutant
BKE19510 (Δ[gene|B412E210FE99EB973818CDD86E56E6F367D7BEFC|yojB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE19510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTTTTTCCTCCTTTA,  downstream forward: _UP4_TAATAAAAAACGGCCTGCAT
BKK19510 (Δ[gene|B412E210FE99EB973818CDD86E56E6F367D7BEFC|yojB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK19510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTTTTTCCTCCTTTA,  downstream forward: _UP4_TAATAAAAAACGGCCTGCAT
References
12107147

B412E210FE99EB973818CDD86E56E6F367D7BEFC

Page visits: 1974

Time of last update: 2024-02-29 10:40:54

Author of last update: Jstuelk