SubtiWiki SubtiWiki
ytvI

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ytvI
168

sporulation protein

locus
BSU_29160
Molecular weight
40.45 kDa
pI
9.37
Protein length
Gene length
function
unknown
product
sporulation protein
essential
no
synonyms
ytvI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0628

This gene is a member of the following regulons

Gene
Coordinates
2,983,164 → 2,984,279
Phenotypes of a mutant
inactivation of ''[gene|B405C91C2724D7DC8DC3970F5D545915C460EFEF|ytvI]'' reduces sporulation efficiency to 14% that of wild type cells [Pubmed|26735940]
The protein
Protein family
[wiki|autoinducer-2 exporter (AI-2E) (TC 2.A.86) family] (according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|B405C91C2724D7DC8DC3970F5D545915C460EFEF|ytvI]
description
[Pubmed|12662922]
regulation
expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|12662922]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|12662922], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|B405C91C2724D7DC8DC3970F5D545915C460EFEF|ytvI]

2021-09-18 16:53:47

ghost

1

68a52a40e4c6a213cca3aa647e74a6fa4d3b6249

91CB392ECC1A2FAA18B3857845E0B8419BD2F711

Biological materials
Mutant
MGNA-A178 (ytvI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/178 NBRP B. subtilis, Japan]
BKE29160 (Δ[gene|B405C91C2724D7DC8DC3970F5D545915C460EFEF|ytvI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29160 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAAAAACGGTCCTCCTCT,  downstream forward: _UP4_TAAAACGGCAGCCGTTTTTT
BKK29160 (Δ[gene|B405C91C2724D7DC8DC3970F5D545915C460EFEF|ytvI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29160 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAAAAACGGTCCTCCTCT,  downstream forward: _UP4_TAAAACGGCAGCCGTTTTTT
References
12662922,26735940

B405C91C2724D7DC8DC3970F5D545915C460EFEF

Page visits: 1065

Time of last update: 2021-10-17 22:53:03

Author of last update: Melvin.boenninger