SubtiWiki SubtiWiki
cccA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

cccA
168

cytochrome c550

locus
BSU_25190
Molecular weight
12.63 kDa
pI
5.28
Protein length
Gene length
function
respiration
product
cytochrome c550
essential
no
synonyms
cccA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2010

This gene is a member of the following regulons

Gene
Coordinates
2,599,523 → 2,599,885
The protein
[wiki|Domains]
transmembrane domain at the N-terminus (aa 5 -25) [Pubmed|2166045]
[wiki|Cofactors]
heme c  [Pubmed|2166045]
[wiki|Localization]
cell membrane (outer side) [Pubmed|2166045]
Expression and Regulation
Operons
genes
[gene|B3EBB417FB2DE3CE6BAFB910E1913785C162EABF|cccA]
description
[Pubmed|22383849]
regulation
carbon catabolite repression ([protein|search|CcpA]) [Pubmed|22900538,11361075,12850135]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, cre site overlaps -35 region of the promoter [Pubmed|11361075], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11361075], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
Open in new tab

[gene|B3EBB417FB2DE3CE6BAFB910E1913785C162EABF|cccA]

2021-04-07 06:06:46

ghost

1

5bfcb42f037b774072923b7b913a7dfce51639e6

54C774AD88F175DF165DAD621649ECFCDB1D47D7

Biological materials
Mutant
BKE25190 (Δ[gene|B3EBB417FB2DE3CE6BAFB910E1913785C162EABF|cccA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25190 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCCCTTCCCCCTTTTT,  downstream forward: _UP4_TAAAAGAACTATTTTTCTCT
BKK25190 (Δ[gene|B3EBB417FB2DE3CE6BAFB910E1913785C162EABF|cccA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25190 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCCCTTCCCCCTTTTT,  downstream forward: _UP4_TAAAAGAACTATTTTTCTCT
References
Reviews
33705278
Original Publications
2171986,10024472,12884008,8383048,2166045,12850135,11361075,22900538,22900538,22383849,20817675,10473570,27503613

B3EBB417FB2DE3CE6BAFB910E1913785C162EABF

Page visits: 1534

Time of last update: 2021-08-31 18:03:16

Author of last update: Jstuelk