SubtiWiki SubtiWiki
adhR

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

adhR
168

transcriptional activator ([wiki|MerR family]) of [gene|352544F3E79943E94E28A6EB5F4C543B529A02D1|adhA]-[gene|0960F1856A81237DBA6AF1FAF36172A63ECBE2D5|yraA], responsive to formaldehyde and methylglyoxal

locus
BSU_27000
Molecular weight
16.30 kDa
pI
9.64
Protein length
Gene length
function
regulation of the protective response to formaldehyde and methylglyoxal
product
transcriptional activator ([wiki|MerR family])
essential
no
synonyms
adhR, yraB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0789

This gene is a member of the following regulons

Gene
Coordinates
2,755,382 → 2,755,804
The protein
Protein family
[wiki|MerR family]
[wiki|Domains]
[wiki|HTH merR-type domain] (aa 1-69) (according to UniProt)
Structure
[PDB|3GP4] (from Listeria monocytogenes, 47% identity)
Modification
activity probably redox-controlled via thiol-(S)-alkylation at Cys-52 by aldehydes [Pubmed|19170879]
[wiki|Localization]
cytoplasmic
Expression and Regulation
Operons
genes
[gene|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|adhR]
description
[pubmed|22383849]
Open in new tab

[gene|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|adhR]

2021-11-23 19:47:47

Jstuelk

6

ab8ec599c1138a02b899f199cff4a4dc992bdedd

589DB7243018B9F813268BA1464CE1AC7D697083

Biological materials
Mutant
MGNA-A238 (yraB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/238 NBRP B. subtilis, Japan]
BKE27000 (Δ[gene|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|adhR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTCACCTCTCTAT,  downstream forward: _UP4_TAGCATTCTTTGCGTGTGAA
BKK27000 (Δ[gene|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|adhR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTCACCTCTCTAT,  downstream forward: _UP4_TAGCATTCTTTGCGTGTGAA
labs
[wiki|Haike Antelmann],University of Greifswald, Germany
References
21722790

B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD

Page visits: 850

Time of last update: 2021-12-02 16:21:54

Author of last update: Melvin.boenninger