SubtiWiki SubtiWiki
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcriptional activator ([wiki|MerR family]) of [gene|352544F3E79943E94E28A6EB5F4C543B529A02D1|adhA]-[gene|0960F1856A81237DBA6AF1FAF36172A63ECBE2D5|yraA], responsive to formaldehyde and methylglyoxal

Molecular weight
16.30 kDa
Protein length
Gene length
regulation of the protective response to formaldehyde and methylglyoxal
transcriptional activator ([wiki|MerR family])
adhR, yraB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0789

This gene is a member of the following regulons

2,755,382 → 2,755,804
The protein
Protein family
[wiki|MerR family]
[wiki|HTH merR-type domain] (aa 1-69) (according to UniProt)
[PDB|3GP4] (from Listeria monocytogenes, 47% identity)
activity probably redox-controlled via thiol-(S)-alkylation at Cys-52 by aldehydes [Pubmed|19170879]
Expression and Regulation
Open in new tab


2021-07-03 02:09:18





Biological materials
MGNA-A238 (yraB::erm), available at the [ NBRP B. subtilis, Japan]
BKE27000 (Δ[gene|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|adhR]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTCACCTCTCTAT,  downstream forward: _UP4_TAGCATTCTTTGCGTGTGAA
BKK27000 (Δ[gene|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|adhR]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTCACCTCTCTAT,  downstream forward: _UP4_TAGCATTCTTTGCGTGTGAA
[wiki|Haike Antelmann],University of Greifswald, Germany


Page visits: 832

Time of last update: 2021-09-10 21:18:05

Author of last update: Melvin.boenninger