SubtiWiki SubtiWiki
ureB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ureB
168

urease (beta subunit)

locus
BSU_36650
Molecular weight
13.50 kDa
pI
9.75
Protein length
Gene length
function
utilization of urea as alternative nitrogen source
product
urease (beta subunit)
essential
no
ec
3.5.1.5
synonyms
ureB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0832

This gene is a member of the following regulons

Gene
Coordinates
3,768,420 → 3,768,794
The protein
Catalyzed reaction/ biological activity
2 H+ + H2O + urea --> CO2 + 2 NH4+ (according to UniProt)
Protein family
urease beta subunit family (single member, according to UniProt)
Structure
[PDB|3UBP] (from B. pasteurii, 48% identity) [pubmed|10368287]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|63CF8C8BBCE39BD585DD5F6C8BBD95E12B500AE6|ywzF]-[gene|1D9596609AEF10456041918BD592E49466D93B1F|ywzE]-[gene|57B6D70B2570C308377B301EC2AF6C232233FD46|ureA]-[gene|B1559A1482B1F5932E6F77B32BF87E7474E01C17|ureB]-[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]
description
[Pubmed|22383849]
Open in new tab

[gene|63CF8C8BBCE39BD585DD5F6C8BBD95E12B500AE6|ywzF]→[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]

2021-08-18 21:21:49

Jstuelk

5

3a346978aa36c52246d401910c25c973229ebcd4

2EC7A375287DC2C117653A7AF0CE944D5ED3C17E

genes
[gene|57B6D70B2570C308377B301EC2AF6C232233FD46|ureA]-[gene|B1559A1482B1F5932E6F77B32BF87E7474E01C17|ureB]-[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]
description
[Pubmed|9287005]
regulation
induced by nitrogen limitation ([protein|search|GlnR], [protein|search|TnrA]) [Pubmed|9287005]
regulatory mechanism
[protein|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]: repression, [Pubmed|9287005], in [regulon|protein:641C4BDD9702804642E1753A9C779E80FABB3919|glnR regulon]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [Pubmed|9287005], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|52C1601482C26400A524E880334BB801F832D6ED|pucR]: activation, [Pubmed|12374841], in [regulon|protein:52C1601482C26400A524E880334BB801F832D6ED|pucR regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|9287005,12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9287005], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|9287005], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab

[gene|57B6D70B2570C308377B301EC2AF6C232233FD46|ureA]→[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]

2021-09-01 18:02:58

ghost

5

2424bd660c3e7e5f26264d885ccc1b3206a82722

869154A4A6E14A6F76FB429E5FEE8D2B62E5A9F8

Biological materials
Mutant
BKE36650 (Δ[gene|B1559A1482B1F5932E6F77B32BF87E7474E01C17|ureB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGCAATTTGAAATGCTCCCG,  downstream forward: _UP4_GGCTGGATGGAGGGTGTAAT
BKK36650 (Δ[gene|B1559A1482B1F5932E6F77B32BF87E7474E01C17|ureB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGCAATTTGAAATGCTCCCG,  downstream forward: _UP4_GGCTGGATGGAGGGTGTAAT
References
Reviews
23539618,19363030
Original Publications
12618455,9287005,9287005,12374841,9287005,16199586,25755103,10368287

B1559A1482B1F5932E6F77B32BF87E7474E01C17

Page visits: 1348

Time of last update: 2021-09-16 15:08:13

Author of last update: Melvin.boenninger