SubtiWiki SubtiWiki
lytG
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

lytG
168

peptidoglycan N-acetylglucosaminidase

locus
BSU_31120
Molecular weight
31.75 kDa
pI
8.28
Protein length
Gene length
function
cell wall turnover
product
peptidoglycan N-acetylglucosaminidase
essential
no
synonyms
lytG, yubE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1705

This gene is a member of the following regulons

Gene
Coordinates
3,190,834 → 3,191,682
The protein
Catalyzed reaction/ biological activity
hydrolysis of the glycosidic bond between N-acetyl-β-d-glucosamine residues and adjacent monosaccharides [Pubmed|18266855]
Protein family
glycosyl hydrolase 73 family (with [protein|29219315D31BA4ADE41687EFF17FE41D6C23D157|lytD], according to UniProt)
[wiki|Domains]
GW domain (aa 203-281) (according to UniProt)
[wiki|Localization]
secreted (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|AF0BC3D534BC2CCCAAB53B286CF4286E58A8A338|lytG]-[gene|E1549CE5B1648EBD1E23890D97F0B545A9EC10F6|yubF]
description
[Pubmed|22383849]
Open in new tab

[gene|AF0BC3D534BC2CCCAAB53B286CF4286E58A8A338|lytG]-[gene|E1549CE5B1648EBD1E23890D97F0B545A9EC10F6|yubF]

2021-08-22 15:12:29

Jstuelk

6

6749b6f58a61d29f4f64a015de1e6fc06928f651

1CD0607137C5EFE63B9162249D85B090424B9C80

Biological materials
Mutant
MGNA-A027 (yubE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/27 NBRP B. subtilis, Japan]
BKE31120 (Δ[gene|AF0BC3D534BC2CCCAAB53B286CF4286E58A8A338|lytG]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31120 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAAAACCTTCCTTCGAA,  downstream forward: _UP4_TAAGCCCTTTTTACTGGTAT
BKK31120 (Δ[gene|AF0BC3D534BC2CCCAAB53B286CF4286E58A8A338|lytG]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31120 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAAAACCTTCCTTCGAA,  downstream forward: _UP4_TAAGCCCTTTTTACTGGTAT
References
Reviews
18266855
Original Publications
12525152,17427287,28448118

AF0BC3D534BC2CCCAAB53B286CF4286E58A8A338

Page visits: 1669

Time of last update: 2021-09-16 19:07:49

Author of last update: Melvin.boenninger