SubtiWiki SubtiWiki
spoVAB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

spoVAB
168

essential for the uptake of the 1:1 chelate of pyridine-2,6-dicarboxylic acid (DPA(2,6)) and Ca(2+) into developing spores, required for spore maturation

locus
BSU_23430
Molecular weight
15.08 kDa
pI
10.12
Protein length
Gene length
function
spore maturation
product
unknown
essential
no
ec
null
synonyms
spoVAB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5835

This gene is a member of the following regulons

Gene
Coordinates
2,442,269 → 2,442,694
The protein
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|5410018998EC9792A69CF0D9C438EEF5AC8A82C5|spoVAA]-[gene|AEC70413BDC29F435776D532E7049AA9A0BD893D|spoVAB]-[gene|B280951A232E941FB0A6C8834049765BE1E16437|spoVAC]-[gene|9531F0A0DC4AE5696FFBAC9C2A773F15840E3255|spoVAD]-[gene|31D6CB7EC20C39C1815CA4552B8B9C4BE304E86B|spoVAEB]-[gene|B44529B69769D7AF1010E06C95E398EA91A3E798|spoVAEA]-[gene|CBE5093DFBBCE25071CCE12408BC9AFF7A158C03|spoVAF]-[gene|02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD|lysA]
description
[Pubmed|7934830]
regulation
expressed late during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG], [wiki|SpoVT]) [Pubmed|15699190,1903432,8755877]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: activation, [Pubmed|8755877], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,1903432], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|5410018998EC9792A69CF0D9C438EEF5AC8A82C5|spoVAA]→[gene|02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD|lysA]

2021-08-12 17:35:37

Jstuelk

4

12fce0add6fb0abbed0128cd99d7be2c377e96d5

420F73950DA10EFCB3126E84B350E66BA95D34DD

Biological materials
Mutant
BKE23430 (Δ[gene|AEC70413BDC29F435776D532E7049AA9A0BD893D|spoVAB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CCCGACAAAAATGATGAACA,  downstream forward: _UP4_GACCATTCATAAGGAGGTTT
BKK23430 (Δ[gene|AEC70413BDC29F435776D532E7049AA9A0BD893D|spoVAB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CCCGACAAAAATGATGAACA,  downstream forward: _UP4_GACCATTCATAAGGAGGTTT
labs
[wiki|Peter Setlow], University of Connecticut Health Center, USA
References
3114420,11751839,15451103,3926949,17158659,6432957,7934830,15699190,1903432,8755877,22328679,21398556

AEC70413BDC29F435776D532E7049AA9A0BD893D

Page visits: 1146

Time of last update: 2021-09-18 21:31:09

Author of last update: Melvin.boenninger