rsoA

rsoA
168

co-sigma factor (with [protein|6359025A73C0BD313F5BCC6F56FE88B820902AAA|sigO])

locus
BSU_33222
Molecular weight
9.00 kDa
pI
4
Protein length
Gene length
function
[wiki|RNA polymerase] [wiki|sigma factor]
product
co-sigma factor (with [protein|6359025A73C0BD313F5BCC6F56FE88B820902AAA|sigO])
essential
no
synonyms
rsoA, rsoA, yvrHa

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,409,219  3,409,458
The protein
[wiki|Domains]
corresponds to region 2 of a [wiki|sigma factor]  [Pubmed|19940246]
Structure
[AF|C0H3R4]
Expression and Regulation
Operons
genes
[gene|6359025A73C0BD313F5BCC6F56FE88B820902AAA|sigO]-[gene|AE8D4F07EFB17DA727D80229C3E72075928AA352|rsoA]
description
[Pubmed|19047353]
regulation
induced by acidic growth conditions [Pubmed|19047353]
regulatory mechanism
[protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]: activation, [Pubmed|16306698], in [regulon|protein:7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb regulon]
sigma factors
[protein|6359025A73C0BD313F5BCC6F56FE88B820902AAA|sigO]: sigma factor, [Pubmed|19047353], in [regulon|protein:6359025A73C0BD313F5BCC6F56FE88B820902AAA|sigO regulon]
[protein|AE8D4F07EFB17DA727D80229C3E72075928AA352|rsoA]: sigma factor, in [regulon|protein:AE8D4F07EFB17DA727D80229C3E72075928AA352|rsoA regulon]
Open in new tab

[gene|6359025A73C0BD313F5BCC6F56FE88B820902AAA|sigO]→[gene|AE8D4F07EFB17DA727D80229C3E72075928AA352|rsoA]

2022-05-21 21:15:16

ghost

11

aea77e80661345e9658f3f3be2c199b9bb41d9a5

7FE05DBCCA24023D39ED5555F02700870F32CAC4

Biological materials
Mutant
BKE33222 ([gene|AE8D4F07EFB17DA727D80229C3E72075928AA352|rsoA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33222 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTGTTCAAACTGGCCGTCCA,  downstream forward: _UP4_TAATATTTTCATATGAAAAA
BKK33222 ([gene|AE8D4F07EFB17DA727D80229C3E72075928AA352|rsoA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33222 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTGTTCAAACTGGCCGTCCA,  downstream forward: _UP4_TAATATTTTCATATGAAAAA
labs
[wiki|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
References
18573182,19940246,26651345,19047353,26367498,26400263,27558998

AE8D4F07EFB17DA727D80229C3E72075928AA352

Page visits: 1809

Time of last update: 2022-07-01 16:08:16

Author of last update: Jstuelk