SubtiWiki SubtiWiki
liaH
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

liaH
168

accessory subunit of the [protein|780FDF3DD260287428B397FFE7F44DDF1917381C|tatAY]-[protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|tatCY] [wiki|protein secretion] complex, similar to phage shock protein, resistance against oxidative stress and cell wall antibiotics (such as daptamycin), secondary bacitracin resistance determinant

locus
BSU_33120
Molecular weight
25.55 kDa
pI
6.17
Protein length
Gene length
function
resistance against oxidative stress and cell wall antibiotics, [wiki|protein secretion]
product
accessory subunit of the [protein|780FDF3DD260287428B397FFE7F44DDF1917381C|tatAY]-[protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|tatCY] [wiki|protein secretion] complex
essential
no
synonyms
liaH, yvqH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1842

This gene is a member of the following regulons

Gene
Coordinates
3,397,846  3,398,523
The protein
Protein family
pspA/IM30 family (with [protein|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|pspA], according to UniProt)
Paralogous protein(s)
[protein|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|pspA]
[wiki|Localization]
variable (spotty) protein [Pubmed|16479537]
throughout the cytoplasm under non-inducing conditions [Pubmed|24666271]
co-localizes with [protein|B6D1159454969D1D578E05D5CE2259E079688510|liaI] in distinct static spots at the cytoplasma membrane under stress conditions [Pubmed|24666271]
Expression and Regulation
Operons
genes
[gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]-[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]
description
[Pubmed|20639339]
regulation
induced by bacitracin and rhamnolipids, induction requires high bacitracin concentrations ([protein|search|LiaR]) [Pubmed|16816187,22092710,26815905]
regulatory mechanism
[protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]: activation, [Pubmed|16816187], in [regulon|protein:49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15273097], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]→[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]

2021-09-14 06:54:06

ghost

6

4515f9113aa08a654b32efa8559976dff13218b4

88031D8530F9F98EF75C918C1D47EDBCF9DEBB70

genes
[gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]-[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]-[gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]-[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]-[gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]-[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]
description
[Pubmed|14651641]
regulation
''[protein|search|liaG]'': constitutive
Open in new tab

[gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]→[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]

2021-09-05 13:41:10

ghost

6

844f52131490c84c9a0558a221a24520579ef3fd

F37C9323D2117C9590CDC8EC3E6B0E3F58AFC1F7

Biological materials
Mutant
MGNA-B039 (yvqH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1038 NBRP B. subtilis, Japan]
BKE33120 ([gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33120 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACCTGATTCCTCCTAAT,  downstream forward: _UP4_TAAGCGGAACGGGGAAGGAT
BKK33120 ([gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33120 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACCTGATTCCTCCTAAT,  downstream forward: _UP4_TAAGCGGAACGGGGAAGGAT
References
Reviews
27344142
Original Publications
19164152,15273097,20057163,16816187,15101989,17660417,16816187,20639339,16479537,20817675,22092710,24666271,27791134,26815905,32302670

AE4BF12C368468C553EED7A696D5EFC63F56CA39

Page visits: 2488

Time of last update: 2021-09-14 19:02:35

Author of last update: Jstuelk