SubtiWiki SubtiWiki
yndD
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yndD
168

part of the [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]-[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]-[wiki|YndF] germinant receptor of unknown specificity

locus
BSU_17750
Molecular weight
57.84 kDa
pI
9.23
Protein length
Gene length
function
[category|SW.4.2.4|Germination]
product
part of the [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]-[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]-[protein|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF] germinant receptor
essential
no
synonyms
yndD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5901

This gene is a member of the following regulons

Gene
Coordinates
1,907,494  1,909,056
The protein
Protein family
[wiki|GerABKA family] (according to UniProt)
Structure
[PDB|6O59] (from B. megaterium, corresponds to aa 37 ... 298, 37.4% identity) [pubmed|31113879]
Paralogous protein(s)
[protein|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|gerKA], [protein|EEDE6A22E91992ABCA677CAB7917B7168C5CB868|gerAA], [protein|3368743E6E03792DB83A38A19989123304DF7560|gerBA], [protein|7CE0CAF27B1C0F507E783B8B80622270B00634FD|yfkQ]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]-[gene|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]-[gene|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF]
description
[Pubmed|16497325]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]→[gene|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF]

2021-09-18 05:55:49

ghost

9

2475fc3f605374c7d03f837ccdb4b7cf919dd1e9

8FEE9610941E29EE00A37E1F39BFC210F89F0F5C

Biological materials
Mutant
MGNA-A022 (yndD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/22 NBRP B. subtilis, Japan]
BKE17750 ([gene|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCACCTTCTTATACAT,  downstream forward: _UP4_TGATGAACTCGACAGGATGG
BKK17750 ([gene|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCACCTTCTTATACAT,  downstream forward: _UP4_TGATGAACTCGACAGGATGG
References
15699190,16497325,10762253,31113879

AE28299B0F274B189DD90554A5A4F7B9A9479B60

Page visits: 1814

Time of last update: 2021-09-18 21:57:48

Author of last update: Jstuelk