SubtiWiki SubtiWiki
sppA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sppA
168

protease, promotes resistance to antimicrobial peptides

locus
BSU_29530
Molecular weight
36.52 kDa
pI
7.31
Protein length
Gene length
function
resistance to lantibiotics
product
protease
essential
no
ec
null
synonyms
sppA, yteI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0616

This gene is a member of the following regulons

Gene
Coordinates
3,020,040  3,021,047
Phenotypes of a mutant
more sensitive to lantibiotics such as nisin and subtilin [Pubmed|33028682,23980836]
reduced long-term survival [pubmed|33028682]
The protein
Catalyzed reaction/ biological activity
serine protease that functions to cleave the remnant signal peptides left behind after [wiki|protein secretion] and cleavage by signal peptidases
Protein family
peptidase S49 family (single member, according to UniProt)
Structure
[PDB|3RST] [Pubmed|22472423]
[wiki|Localization]
cell membrane [Pubmed|33028682,22472423]
Expression and Regulation
Operons
genes
[gene|ACB7F015027A83C5D3457818A71B6F47192CEFBE|sppA]-[gene|618337D9BCD1586C5874746D1001DA3A2724E57C|sppI]
description
[Pubmed|9987136]
regulation
induced in response to cell wall stress ([protein|search|SigW]) [Pubmed|12207695]
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|9987136,12207695], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
additional information
self-processes its own C-termini [PubMed|24228759]
Open in new tab

[gene|ACB7F015027A83C5D3457818A71B6F47192CEFBE|sppA]→[gene|618337D9BCD1586C5874746D1001DA3A2724E57C|sppI]

2021-09-18 05:56:00

ghost

5

fe4ea970b049e58e6ace5cd905f3c2fe02d6fbfa

713591724CAF4DF2F847A19D64AF155120CBB192

Biological materials
Mutant
MGNA-A005 (yteI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/5 NBRP B. subtilis, Japan]
BKE29530 ([gene|ACB7F015027A83C5D3457818A71B6F47192CEFBE|sppA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCTCCTCCTTTTT,  downstream forward: _UP4_TATGCGAAGTAGGAGGGAAC
BKK29530 ([gene|ACB7F015027A83C5D3457818A71B6F47192CEFBE|sppA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCTCCTCCTTTTT,  downstream forward: _UP4_TATGCGAAGTAGGAGGGAAC
References
Reviews
34410368
Original Publications
9987136,12207695,22472423,23980836,24228759,24228759,31424929,33028682

ACB7F015027A83C5D3457818A71B6F47192CEFBE

Page visits: 2676

Time of last update: 2021-09-19 13:13:14

Author of last update: Jstuelk