SubtiWiki SubtiWiki
iolX
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

iolX
168

scyllo-inositol 2-dehydrogenase

locus
BSU_10850
Molecular weight
37.33 kDa
pI
5.3
Protein length
Gene length
function
utilization of scyllo-inositol
product
scyllo-inositol 2-dehydrogenase
essential
no
synonyms
iolX, yuxD, yucG, yisS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0673

This gene is a member of the following regulons

Gene
Coordinates
1,164,370  1,165,398
Phenotypes of a mutant
impaired growth with scyllo-inositol as the only carbon source [Pubmed|20133360]
The protein
Catalyzed reaction/ biological activity
NAD+ + scyllo-inositol --> H+ + NADH + scyllo-inosose (according to UniProt)
Protein family
[wiki|Gfo/Idh/MocA family] (according to UniProt)
[wiki|Cofactors]
NAD+ [pubmed|28693424]
Structure
[PDB|3EZY] (from Thermotoga maritima, 37% identity)
Paralogous protein(s)
[protein|03BE6DA854612B3F6741E0E167AB310F0DE96285|yfiI], [protein|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|ntdC], [protein|484D17480DFAD3667E0EBC6D38854A7546A8DB46|yteT], [protein|920C5750CB95102B073C32874D512E8D636D2C7D|iolU], [protein|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|iolG], [protein|942BAE9FA023DFCA06B6D26A856A72F2979E23FA|yrbE], [protein|7DFE74C751A67CCC84579D52005E1399B0A10166|iolW]
Expression and Regulation
Operons
genes
[gene|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|iolX]
description
[pubmed|22383849]
regulation
induced by scyllo-inositol [pubmed|28693424]
regulatory mechanism
[protein|17F5188958A415D8D09439E02E1D1E0661B5C760|iolQ]: repression, [pubmed|28693424], in [regulon|protein:17F5188958A415D8D09439E02E1D1E0661B5C760|iolQ regulon]
Open in new tab

[gene|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|iolX]

2021-06-28 22:49:04

Jstuelk

5

2323c37767d17c2578c469c1daee774c488632a7

063B871B7FF975AF6EB4CBCB262E200AA3D8B6AB

Biological materials
Mutant
MGNA-B191 (yisS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1190 NBRP B. subtilis, Japan]
BKE10850 ([gene|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|iolX]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10850 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTCCCATCCTCTCCTTT,  downstream forward: _UP4_TAAAAGCTAAGTATGTTGCA
BKK10850 ([gene|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|iolX]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10850 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTCCCATCCTCTCCTTT,  downstream forward: _UP4_TAAAAGCTAAGTATGTTGCA
References
20133360,28693424

AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06

Page visits: 1336

Time of last update: 2021-09-17 10:42:43

Author of last update: Melvin.boenninger