SubtiWiki SubtiWiki
yqzO
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqzO
168

unknown, Skin element

locus
BSU_26259
Molecular weight
5.50 kDa
pI
9.994
Protein length
Gene length
function
unknown
product
unknown
essential
-
synonyms
yqzO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,693,457  2,693,606
The protein
Structure
[PDB|4XDI] (from Chlamydomonas reinhardtii, 38% identity in the N-terminal part (68% of YqzO)) [pubmed|26057801]
Expression and Regulation
Operons
genes
[gene|A9AACF8F25A1A80B3AE2A94DFC3A0E09012B55E7|yqzO]-[gene|3A89444BA25E4940C4197AACBD8B66BC1C65A493|yqaN]
description
[Pubmed|22383849]
regulation
expressed during [wiki|sporulation] [Pubmed|22383849]
Open in new tab

[gene|A9AACF8F25A1A80B3AE2A94DFC3A0E09012B55E7|yqzO]→[gene|3A89444BA25E4940C4197AACBD8B66BC1C65A493|yqaN]

2021-07-10 08:42:08

Jstuelk

2

2c7f998ab2a607f93eb2d00196f3b6b45861241e

12944225AA6B307CBDF234A591AF02DF8629A578

genes
[gene|16BEDCFFB1671793061ACE4AC528D3B8EB177DC8|yqaF]-[gene|02216407B5EDB98FAF611E22B2323C819B9D58BB|yqdA]-[gene|03DAF537379754763646AF3AF2AD811B107F5302|yqaG]-[gene|F6AB74740776179E77218DB831FEE03773B7353F|yqaH]-[gene|5EA0F507F949D249D5B5B860861BBEB4197E01C5|yqaI]-[gene|CFCCFD8C6420CC1DD076B091AD3D914FC8AB22D5|yqaJ]-[gene|903E11BD2CFF3EE1A831F0F50F91741893C3DAB8|yqaK]-[gene|AB4AF9BD3E16FD72370AFC82CDD1531518053E6F|yqaL]-[gene|F301EA8201BF27BAFAD4F95EC3A580A91B970B06|yqaM]-[gene|A9AACF8F25A1A80B3AE2A94DFC3A0E09012B55E7|yqzO]-[gene|3A89444BA25E4940C4197AACBD8B66BC1C65A493|yqaN]
description
[Pubmed|20889742]
regulation
not expressed during normal growth ([protein|846161AE54F170075F2B2133A8D56FE39A5AF8D9|sknR]) [Pubmed|20889742]
regulatory mechanism
[protein|846161AE54F170075F2B2133A8D56FE39A5AF8D9|sknR]: repression, [Pubmed|20889742], in [regulon|protein:846161AE54F170075F2B2133A8D56FE39A5AF8D9|sknR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|20889742], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
A [protein|search|ncRNA] is predicted between [gene|CFCCFD8C6420CC1DD076B091AD3D914FC8AB22D5|yqaJ] and [gene|5EA0F507F949D249D5B5B860861BBEB4197E01C5|yqaI] [PubMed|20525796]
Open in new tab

[gene|16BEDCFFB1671793061ACE4AC528D3B8EB177DC8|yqaF]→[gene|3A89444BA25E4940C4197AACBD8B66BC1C65A493|yqaN]

2021-08-14 08:20:37

Jstuelk

5

e470304f15cd37310c8ed727bb7e0f54ad7c2747

7A6791A58F019385F6E775ED3FB2F9370F7F8AD1

Biological materials
Mutant
BKE26259 ([gene|A9AACF8F25A1A80B3AE2A94DFC3A0E09012B55E7|yqzO]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26259 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGCTTTTATATTCGTTTTCT,  downstream forward: _UP4_TAAAGCAGTCGTGTCTCTGC
BKK26259 ([gene|A9AACF8F25A1A80B3AE2A94DFC3A0E09012B55E7|yqzO]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26259 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGCTTTTATATTCGTTTTCT,  downstream forward: _UP4_TAAAGCAGTCGTGTCTCTGC
References
20889742,26057801

A9AACF8F25A1A80B3AE2A94DFC3A0E09012B55E7

Page visits: 715

Time of last update: 2021-08-12 20:29:33

Author of last update: Jstuelk