SubtiWiki SubtiWiki
yetM
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yetM
168

FAD-dependent monooxygenase

locus
BSU_07230
Molecular weight
40.82 kDa
pI
5.34
Protein length
Gene length
function
unknown
product
FAD-dependent monooxygenase
essential
no
synonyms
yetM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0654

This gene is a member of the following regulons

Gene
Coordinates
790,318  791,427
The protein
[wiki|Cofactors]
FAD (according to UniProt) [Pubmed|21635694]
Structure
[PDB|4H2N] (from Mesorhizobium japonicum, 30% identity)
Expression and Regulation
Operons
genes
[gene|A70EA4AEBF46ED2279E8BCE8A28439078484B6E3|yetM]
description
[Pubmed|19329649]
regulation
induced by flavonoids of kaempferol, apigenin, and luteolin ([protein|search|YetL])[Pubmed|19329649]
regulatory mechanism
[protein|BFAFC2CFA7F2FDA639B367C579E2A46242BA3DBD|yetL]: repression, [Pubmed|19329649], in [regulon|protein:BFAFC2CFA7F2FDA639B367C579E2A46242BA3DBD|yetL regulon]
Open in new tab

[gene|A70EA4AEBF46ED2279E8BCE8A28439078484B6E3|yetM]

2021-06-28 16:37:35

ghost

2

5640ea7e1110afa4abc594ea1ecf492dbcbd4896

D4B575EFB104A4013A70B57E1145986C255EFCD8

Biological materials
Mutant
MGNA-B464 (yetM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1463 NBRP B. subtilis, Japan]
BKE07230 ([gene|A70EA4AEBF46ED2279E8BCE8A28439078484B6E3|yetM]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCAATAACCACCTTTT,  downstream forward: _UP4_TAAATAGGAAAAGTCCAGAA
BKK07230 ([gene|A70EA4AEBF46ED2279E8BCE8A28439078484B6E3|yetM]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCAATAACCACCTTTT,  downstream forward: _UP4_TAAATAGGAAAAGTCCAGAA
References
19329649,19329649

A70EA4AEBF46ED2279E8BCE8A28439078484B6E3

Page visits: 1040

Time of last update: 2021-09-02 01:54:17

Author of last update: Jstuelk