SubtiWiki SubtiWiki
ykoM

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ykoM
168

similar to transcriptional regulator ([wiki|MarR family])

locus
BSU_13340
Molecular weight
17.72 kDa
pI
9.47
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ykoM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

Gene
Coordinates
1,398,496  1,398,960
The protein
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 14-146) (according to UniProt)
Structure
[PDB|3ZPL] (from Steptomyces coelicolor, corresponds to aa 17 ... 142, 24.6% identity) [pubmed|23748564]
Paralogous protein(s)
[protein|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]
Expression and Regulation
Operons
genes
[gene|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]
description
[pubmed|22383849]
Open in new tab

[gene|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]

2021-10-08 23:13:40

Jstuelk

4

28c8337d14bc64a4921c8c07bd673f87e5db791a

DE624546F159FE1BB2D7C163F25FD3CF669B96B0

Biological materials
Mutant
BKE13340 ([gene|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCTACCTCGTATATAG,  downstream forward: _UP4_TTTCGTTAACTATTCTACAC
BKK13340 ([gene|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCTACCTCGTATATAG,  downstream forward: _UP4_TTTCGTTAACTATTCTACAC
GP2873 (''[gene|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]''::''zeo''), available in [wiki|Jörg Stülke]'s lab
References
Research papers
23748564

A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC

Page visits: 1334

Time of last update: 2021-10-20 14:03:27

Author of last update: Melvin.boenninger