SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


similar to transcriptional regulator ([wiki|MarR family])

Molecular weight
17.72 kDa
Protein length
Gene length

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

1,398,496  1,398,960
The protein
[wiki|HTH marR-type domain] (aa 14-146) (according to UniProt)
[PDB|3ZPL] (from Steptomyces coelicolor, corresponds to aa 17 ... 142, 24.6% identity) [pubmed|23748564]
Paralogous protein(s)
Expression and Regulation
Open in new tab


2021-12-17 08:19:37





Biological materials
BKE13340 ([gene|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCTACCTCGTATATAG,  downstream forward: _UP4_TTTCGTTAACTATTCTACAC
BKK13340 ([gene|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCTACCTCGTATATAG,  downstream forward: _UP4_TTTCGTTAACTATTCTACAC
GP2873 (''[gene|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]''::''zeo''), available in [wiki|Jörg Stülke]'s lab
Research papers


Page visits: 1359

Time of last update: 2022-01-09 21:35:24

Author of last update: Melvin.boenninger