SubtiWiki SubtiWiki
yxiS
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yxiS
168

general stress protein, survival of ethanol, paraquat and salt stresses

locus
BSU_39040
Molecular weight
10.99 kDa
pI
4.89
Protein length
Gene length
function
survival of stress conditions
product
unknown
essential
no
ec
null
synonyms
yxiS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
4,007,803  4,008,093
Expression and Regulation
Operons
genes
[gene|03FE63D6AAC77D6CEB052D0BF578ACD048C772FB|katE]-[gene|A647A29CAEA5D7188A08868A4397B4DF8A575710|yxiS]
description
[Pubmed|10746760]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|11544224]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|7559348,15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|03FE63D6AAC77D6CEB052D0BF578ACD048C772FB|katE]→[gene|A647A29CAEA5D7188A08868A4397B4DF8A575710|yxiS]

2021-08-29 22:15:32

ghost

6

4d4d0ba07a595410e445077a08e490430c5a2dce

59C28339C2EF537D2ABE4C37D2474E54CD8C8726

Biological materials
Mutant
MGNA-B797 (yxiS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1796 NBRP B. subtilis, Japan]
BKE39040 ([gene|A647A29CAEA5D7188A08868A4397B4DF8A575710|yxiS]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCATGCTCCTTATG,  downstream forward: _UP4_TAAAAAAAGAGACATCCTGT
BKK39040 ([gene|A647A29CAEA5D7188A08868A4397B4DF8A575710|yxiS]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCATGCTCCTTATG,  downstream forward: _UP4_TAAAAAAAGAGACATCCTGT
References
16672620,15805528,22582280

A647A29CAEA5D7188A08868A4397B4DF8A575710

Page visits: 862

Time of last update: 2021-09-01 20:03:42

Author of last update: Bzhu