SubtiWiki SubtiWiki
araR
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

araR
168

transcriptional repressor ([wiki|GntR family], [wiki|LacI family]) of the arabinose utilization genes

locus
BSU_33970
Molecular weight
43.00 kDa
pI
6.34
Protein length
Gene length
function
regulation of arabinose utilization
product
transcriptional repressor ([wiki|GntR family], [wiki|LacI family])
essential
no
synonyms
araR, araC, yvbS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1609

This gene is a member of the following regulons

Gene
Coordinates
3,485,604  3,486,758
Phenotypes of a mutant
inactivation of ''[gene|A567466894AE9DE7CDE7816615433A37532297B5|araR]'' reduces sporulation efficiency to 28% that of wild type cells [Pubmed|26735940]
The protein
Protein family
[wiki|GntR family]: N-terminal DNA-binding domain, [wiki|LacI family]: C-terminal effector-binding domain
[wiki|Domains]
N-terminal DNA-binding domain ([wiki|GntR family])
C-terminal effector-binding domain ([wiki|LacI family])
[wiki|HTH gntR-type domain] (aa 1-70) (according to UniProt)
Structure
[PDB|3TB6] (effector-binding domain) [Pubmed|22281747]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|A567466894AE9DE7CDE7816615433A37532297B5|araR]
description
[Pubmed|9045819]
regulation
induced by arabinose ([protein|search|AraR]) [Pubmed|10417639]
regulatory mechanism
[protein|A567466894AE9DE7CDE7816615433A37532297B5|araR]: repression, [Pubmed|10417639], in [regulon|protein:A567466894AE9DE7CDE7816615433A37532297B5|araR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9401028], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|A567466894AE9DE7CDE7816615433A37532297B5|araR]

2021-06-27 00:06:59

ghost

2

d2286298f3ef689746c3c4c984f3c45640b8c9d3

5D0C5E53C9A992BBDE4EE32495B12C8CA2AFA294

Biological materials
Mutant
BKE33970 ([gene|A567466894AE9DE7CDE7816615433A37532297B5|araR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCCATTCCTCCAAAAT,  downstream forward: _UP4_TAAAAAAAGCAATGTATGGG
BKK33970 ([gene|A567466894AE9DE7CDE7816615433A37532297B5|araR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCCATTCCTCCAAAAT,  downstream forward: _UP4_TAAAAAAAGCAATGTATGGG
References
17617643,3131313,16585763,10417639,11418559,14973026,9045819,23109551,25364981,22281747,26151451,26511320,26735940

A567466894AE9DE7CDE7816615433A37532297B5

Page visits: 2867

Time of last update: 2021-09-16 14:19:45

Author of last update: Melvin.boenninger