SubtiWiki SubtiWiki
bcd
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

bcd
168

valine dehydrogenase, isoleucine dehydrogenase, L-leucine dehydrogenase

locus
BSU_24080
Molecular weight
39.83 kDa
pI
4.94
Protein length
Gene length
function
utilization of branched-chain keto acids
product
valine dehydrogenase, isoleucine dehydrogenase, L-leucine dehydrogenase
essential
no
ec
1.4.1.9
synonyms
bcd, bkd, yqiT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0334

This gene is a member of the following regulons

Gene
Coordinates
2,502,659  2,503,753
The protein
Catalyzed reaction/ biological activity
L-leucine + H2O + NAD+ --> 4-methyl-2-oxopentanoate + NH4+ + NADH + H+ (according to UniProt)
Protein family
Glu/Leu/Phe/Val dehydrogenases family (with [protein|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB] and [protein|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG], according to UniProt)
Structure
[PDB|1LEH] (from '' Lysinibacillus sphaericus'', 71% identity, 82% similarity) [Pubmed|8591046]
Expression and Regulation
Operons
genes
[gene|1CFF7202AC6078B6BAD1253F77FD4FE227C046DB|ptb]-[gene|A52E50104B18D0A8518218C52D9CC36FDDB29AAF|bcd]-[gene|8E08A0333E4EC89003DA3C1DD8DCD39CDDC8624C|buk]-[gene|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|lpdV]-[gene|9F298088C0A9EB7FE140C935AFC9243C6D4DE8AE|bkdAA]-[gene|A024921961A786294199EA12E04456C890ED8D8C|bkdAB]-[gene|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB]
description
[Pubmed|12823818]
regulation
induced in the presence of isoleucine or valine ([protein|search|BkdR]) [Pubmed|10094682]
regulatory mechanism
[protein|4CEBD81F485DD0B660E297FFC34A0F5270652184|bkdR]: activation, [Pubmed|10094682], in [regulon|protein:4CEBD81F485DD0B660E297FFC34A0F5270652184|bkdR regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|10094682], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
sigma factors
[protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]: sigma factor, [Pubmed|10094682], in [regulon|protein:1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL regulon]
Open in new tab

[gene|1CFF7202AC6078B6BAD1253F77FD4FE227C046DB|ptb]→[gene|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB]

2021-09-08 20:43:15

ghost

8

7b8921dc3f8fdb775067a1f92187895088ac1126

0BF3F61A9229E387986A64E3D2F9F647D24EA48A

Biological materials
Mutant
MGNA-C427 (yqiT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2425 NBRP B. subtilis, Japan]
a ''bcd'' mutant and a ''[gene|A52E50104B18D0A8518218C52D9CC36FDDB29AAF|bcd] [gene|2A20EF701B9F78FC21A33D6BD8ED862323BA59A8|ybgE] [gene|8163996FCB9D02F771E7A04A91D5720027260F12|ywaA]'' triple mutant are available in [wiki|Linc Sonenshein]'s lab
BKE24080 ([gene|A52E50104B18D0A8518218C52D9CC36FDDB29AAF|bcd]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAAAAGTTCCATGTTCGTTC,  downstream forward: _UP4_CGTTAAGAAATTGATCTGGA
BKK24080 ([gene|A52E50104B18D0A8518218C52D9CC36FDDB29AAF|bcd]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAAAAGTTCCATGTTCGTTC,  downstream forward: _UP4_CGTTAAGAAATTGATCTGGA
References
Reviews
7705101
Original Publications
12427936,15241682,10094682,12823818,24843172,30993221

A52E50104B18D0A8518218C52D9CC36FDDB29AAF

Page visits: 1117

Time of last update: 2021-09-17 10:56:38

Author of last update: Melvin.boenninger