SubtiWiki SubtiWiki
yngL
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yngL
168

unknown

locus
BSU_18290
Molecular weight
14.53 kDa
pI
9.62
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yngL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,959,695  1,960,087
The protein
Protein family
UPF0713 family (with [protein|53898B42C9B09C87F2EE23BAA3433E93DC2DA42E|yjcA], according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|A5238B160277C6440977DE099D3414E2A83ACD81|yngL]
description
[Pubmed|22383849]
regulation
expressed during [wiki|sporulation] [Pubmed|22383849]
Open in new tab

[gene|A5238B160277C6440977DE099D3414E2A83ACD81|yngL]

2021-04-22 08:41:02

Jstuelk

2

1e384db0a50d702b909b16b70a3b8871039d2967

A3DF4AF8E1A3B687FEBB8297480D86BE799C9B95

Biological materials
Mutant
MGNA-B085 (yngL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1084 NBRP B. subtilis, Japan]
BKE18290 ([gene|A5238B160277C6440977DE099D3414E2A83ACD81|yngL]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGAGAAGCCTCCAAGAA,  downstream forward: _UP4_TAAAAGCGGTTCACAACATG
BKK18290 ([gene|A5238B160277C6440977DE099D3414E2A83ACD81|yngL]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGAGAAGCCTCCAAGAA,  downstream forward: _UP4_TAAAAGCGGTTCACAACATG

A5238B160277C6440977DE099D3414E2A83ACD81

Page visits: 851

Time of last update: 2021-09-14 15:55:40

Author of last update: Melvin.boenninger