SubtiWiki SubtiWiki
citG
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

citG
168

fumarase

locus
BSU_33040
Molecular weight
50.36 kDa
pI
5.47
Protein length
Gene length
function
TCA cycle
product
fumarate hydratase
essential
no
ec
4.2.1.2
synonyms
citG, fumC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0114

This gene is a member of the following regulons

Gene
Coordinates
3,389,024 3,390,412
The protein
Catalyzed reaction/ biological activity
(S)-malate --> fumarate + H2O (according to UniProt)
Protein family
class-II fumarase/aspartase family (with [protein|5FAE80F22AEBAE63FC3C872EC651166A65C34DC2|ansB], according to UniProt)
Structure
[PDB|1FUO] (from ''E. coli'', 64% identity) [Pubmed|8909293]
Paralogous protein(s)
[protein|5FAE80F22AEBAE63FC3C872EC651166A65C34DC2|ansB]
[wiki|Localization]
forms discrete foci in the cytoplasm [pubmed|29140245]
colocalizes with DNA upon DNA damage (MMS treatment) [pubmed|29140245]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]
description
[Pubmed|3923430]
regulation
constitutive
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|3130545,2509422,2509423], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|3130545,2509422], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab

[gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]

2021-08-26 20:26:15

ghost

2

c60283e11ed078a2911215c6aad60191ae655c29

425114B01075D5818A5FAAAE4EBC4B2E103B078B

genes
[gene|B66AE23754A9CD4D5BCFC75CE6918522C7A22DA6|yvzF]-[gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]
description
[Pubmed|22383849]
Open in new tab

[gene|B66AE23754A9CD4D5BCFC75CE6918522C7A22DA6|yvzF]→[gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]

2021-08-20 17:55:01

Jstuelk

4

c28acc96673d71951fe74a0d40b62855c8b1ac77

B19CAD8573AA314740B2D7087906641C90CBC9B6

Biological materials
Mutant
GP718 (spec), available in [wiki|Jrg Stlke]'s lab [pubmed|20933603]
GP2340 ''[gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]''::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [wiki|Jrg Stlke]'s lab
GP2341 ''[gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]''::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [wiki|Jrg Stlke]'s lab
BKE33040 ([gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATGTATCCCTCCATA, downstream forward: _UP4_TAATAGGAAGAACGGCTGCT
BKK33040 ([gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATGTATCCCTCCATA, downstream forward: _UP4_TAATAGGAAGAACGGCTGCT
Expression vectors
pGP1122 (N-terminal Strep-tag, for [wiki|SPINE], purification from ''B. subtilis'', in [wiki|pGP380]) (available in [wiki|Jrg Stlke]'s lab) [pubmed|20933603]
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jrg Stlke]'s lab
FLAG-tag construct
GP1132 (spc, based on [wiki|pGP1331]), available in [wiki|Jrg Stlke]'s lab
lacZ fusion
pGP387 (in [wiki|pAC7]), available in [wiki|Jrg Stlke]'s lab
Antibody
**
GFP fusion
GP1433 (spc, based on [wiki|pGP1870]), available in the [wiki|Jrg Stlke] lab
References
2509422,3923430,3130545,2509423,20933603,15378759,6098632,8909293,29140245

A3A2EF3C95B833A11843553107D781EDEFF0BC41

Page visits: 1939

Time of last update: 2021-09-18 22:03:31

Author of last update: TPed